Proc. Natl. Acad. Sci. USA Vol. 95, pp. 5700–5705, May 1998 Immunology The mosquito Anopheles stephensi limits malaria parasite development with inducible synthesis of nitric oxide SHIRLEY LUCKHART*†,YORAM VODOVOTZ‡§,LIWANG CUI†, AND RONALD ROSENBERG† †Department of Entomology, Walter Reed Army Institute of Research, Washington, DC 20307; and ‡National Cancer Institute, Radiation Biology Branch, Bethesda, MD 20892 Communicated by Louis H. Miller, National Institute of Allergy and Infectious Diseases, Bethesda, MD, March 11, 1998 (received for review November 25, 1997) ABSTRACT We have discovered that the mosquito Anoph- 8). Our discovery of inducible NOS activity in A. stephensi, eles stephensi, a natural vector of human malaria, limits therefore, demonstrates that mosquitoes and vertebrates share a parasite development with inducible synthesis of nitric oxide conserved anti-Plasmodium defense. (NO). Elevated expression of A. stephensi NO synthase (NOS), which is highly homologous to characterized NOS genes, was MATERIALS AND METHODS detected in the midgut and carcass soon after invasion of the midgut by Plasmodium. Early induction is likely primed by Mosquito Maintenance and Plasmodium Infections. A. ste- bacterial growth in the blood meal. Later increases in A. phensi were produced at 27°C and 75% relative humidity under stephensi NOS expression and enzyme activity occurred at the a 12-hr lightydark cycle. For P. berghei infections, mosquitoes beginning of sporozoite release. Circulating levels of nitritey were fed one time (day 0) on anesthetized Institute of Cancer nitrate, end-products of NO synthesis, were significantly Research mice and maintained on sugar cubes and water at higher in Plasmodium-infected mosquitoes. Dietary provision 21°C and 75% relative humidity until use. For P. falciparum of the NOS substrate L-arginine reduced Plasmodium infec- infections, mosquitoes were membrane-fed one time on human tions in A. stephensi. In contrast, dietary provision of a NOS blood with strain NF54 and maintained on sugar and water at inhibitor significantly increased parasite numbers in infected normal rearing conditions until use. Hereafter, these mosqui- mosquitoes, confirming that A. stephensi limits Plasmodium toes are referred to as ‘‘infected’’ or ‘‘P. sp.-infected.’’ Controls development with NO. were fed one time on uninfected mice or human blood and maintained until use under the appropriate environmental Global efforts to control malaria, caused by parasitic protozoa conditions; these mosquitoes are referred to as ‘‘blood fed of the genus Plasmodium, have been hindered by insecticide- uninfected.’’ For studies of midgut bacteria, mosquitoes (non- resistant mosquitoes, drug-resistant parasites, and socioeco- blood fed, blood fed uninfected, and P. berghei-infected) were nomic obstacles. The drive to identify novel control strategies provided with sugar and either water- or gentamicin-soaked has, in part, focused on identifying mosquito gene products (50 mgyml in water, Sigma) sterile cotton from 3 days before that impart refractory phenotypes, including those associated blood feeding until termination of the experiment. For NOS with the immune response to pathogens (1–3). inhibition experiments, mosquitoes were provided with gen- Plasmodium development in Anopheles begins with ingestion tamicin-soaked (50 mgyml in water) sterile cotton for 3 days by the mosquito of blood containing gametocytes; parasite before blood feeding. Immediately before membrane feeding, fertilization commences within minutes of ingestion. Mobile Nv-nitro-L-arginine methyl ester (1 mgyml, L-NAME, Sigma) zygotes, or ookinetes, penetrate the midgut epithelium 24–36 or the biologically inactive D-NAME (1 mgyml, Sigma) was hr later and rapidly transform into vegetative oocysts under the added to the P. falciparum blood culture. Blood fed mosquitoes basal lamina in the hemolymph-filled, open circulatory system were maintained on the same treatments, provided as water- of the mosquito. After growth and development for 10–12 soaked sterile cotton balls and changed daily, until dissection. days, thousands of haploid sporozoites are released from each RNA Isolation and Analysis by Reverse Transcriptase–PCR oocyst into the hemolymph. Hemolymph circulation and (RT-PCR). Total RNA was isolated using TriZOL (Life Tech- sporozoite movement carry a fraction of the parasites to the nologies,Gaithersburg, MD). Preliminary RT-PCR detected salivary glands, where they are released into the saliva during identical NOS expression in P. berghei- and P. falciparum- subsequent blood feeding. infected mosquitoes at 14–16 days post-blood meal (pBM) We have discovered that A. stephensi, a major vector of human using degenerate primers designed against Drosophila nos malaria in India and a competent laboratory host for the murine (DNOS) (9). Temporal A. stephensi NOS (AsNOS) expression parasite P. berghei, limits parasite development with inducible was studied by using semiquantitative RT-PCR (10, 11). Total synthesis of nitric oxide (NO). The free radical NO, produced RNA was isolated from 30–40 each non-blood fed, blood fed during the oxidation of L-Arg to L-Citrulline (L-Cit) by NO uninfected, and P. berghei-infected mosquitoes at 1, 2, 3, 6, 9, synthase (NOS), has diverse roles in vertebrate physiology. Three 14, and 18 days pBM or from 25–40 midguts and carcasses genes encode distinct vertebrate NOS isoforms: two are consti- without midguts at 1, 2, and 3 days post-P. berghei infection. tutively expressed whereas the third is an inducible immune First-strand cDNA was synthesized by using 0.5 mg of oli- effector (4). Inducible NOS and NO are synthesized in response to bacterial, viral, and parasitic infections in vertebrates (5, 6). Abbreviations: L-NAME, Nv-nitro-L-arginine methyl ester; NOS, NO During Plasmodium infection in humans and mice, NO inacti- synthase; DNOS, Drosophila NOS; RT-PCR, reverse transcriptase- vates liver-invading sporozoites and blood-stage gametocytes (7, PCR; pBM, post-blood meal; AsNOS, A. stephensi NOS; L-Cit, L- citrulline. The publication costs of this article were defrayed in part by page charge Data deposition: The sequence reported in this paper has been deposited in the GenBank database (accession no. AF053344). payment. This article must therefore be hereby marked ‘‘advertisement’’ in *To whom reprint requests should be addressed at: Department of accordance with 18 U.S.C. §1734 solely to indicate this fact. Biochemistry, 111 Engel Hall, Virginia Tech, Blacksburg, VA 24061. 0027-8424y98y955700-6$0.00y0 §Present address: Cardiology Research Foundation 110 Irving St. NW, PNAS is available online at http:yywww.pnas.org. Washington, DC 20010. 5700 Downloaded by guest on September 26, 2021 Immunology: Luckhart et al. Proc. Natl. Acad. Sci. USA 95 (1998) 5701 go(dT) primer and Superscript II (Life Technologies). A each non-blood fed, blood fed uninfected, or P. berghei- 250-bp AsNOS fragment was amplified by 35 cycles of PCR infected mosquitoes were measured as the rate of conversion (94°C for 40 sec, 53°C for 40 sec, and 72°C for 40 sec) with the of [3H]Arg to [3H]Cit per mg of homogenate at 6 and 9 days primers 59-ACATCAAGACGGAAATGGTTG 39 and 59- pBM using the NOSdetect kit (Stratagene). Assays followed ACAGACGTAGATGTGGGCCTT 39; for replicates of tis- blood digestion (4–5 days at 21°C, unpublished observation) to sue-specific assays, a 180-bp AsNOS fragment was amplified avoid interference by host blood proteins. Activity was mea- using identical conditions and the nested primer pair 59- sured with or without the NOS inhibitor L-NAME (1 mM). ACTGCAAGATTCCCAAGGTAT 39 and 59-ATTCCGC- Data were analyzed using contingency tables (a 5 0.05). 9 y 2y 2 CTCTTTGAGGGCAA 3 . Transcript abundance was nor- Hemolymph nitrite nitrate (NO2 NO3 ) concentration was malized against a 300-bp b-actin fragment amplified by using measured using a modified cadmium reductionyGriess reagent the described PCR conditions for 15 cycles with primers microassay (24) after collection (25) from groups of 100–200 designed against A. gambiae b-actin (12). For tissue-specific blood fed uninfected and P. berghei-infected mosquitoes at 7, assays, AsNOS transcript abundance was normalized against a 9–10, and 14–15 days pBM. Midgut blood contamination of 460-bp ribosomal S7 protein gene fragment amplified using 25 hemolymph precluded the use of earlier time points. Data for cycles of PCR (94°C for 30 sec, 55°C for 30 sec, and 72°C for each time point were analyzed by one-tailed paired t test (a 5 40 sec) and published primers (13, 14). Amplimers were 0.075). 32 labeled by incorporation of [ P]dATP, separated in 1.5% The impact of NO on Plasmodium in A. stephensi was agarose gels, transferred to nylon, and exposed to X-Omat film assessed with dietary supplements. Three days before blood (Kodak). For signal quantitation, autoradiographs were feeding, two replicates of four groups of mosquitoes were scanned into RIT120 software (Radiological Imaging Technol- provided with sugar cubes and water alone or sugar cubes and ogy, Colorado Springs, CO) by using a Lumiscan 150 laser the NOS substrate L-Arg (0.2% or 0.002%) in water or L-Cit digitizer (Lumisys, Sunnyvale, CA). For midgut and carcass (0.2%) in water. On day 0, all of the groups were fed on a single expression, data from three replicates were analyzed by one- a 5 P. berghei-infected hamster. At day 10, mosquitoes were dis- tailed paired t test ( 0.075). sected to count midgut oocysts. In other experiments, two AsNOS Cloning and Sequencing. The genomic cognate of replicates of three groups of mosquitoes were provided with AsNOS (unpublished data) was constructed by using Genetics sugar cubes and gentamicin (50 mgyml) in water for three days Computer Group software (15) assembly of sequence from before blood feeding. On day 0, L-NAME (1 mgyml) or four EMBL3 SP6yT7 clones (CLONTECH) isolated by high- y 32 D-NAME (1 mg ml) was added to aliquots of a single P. stringency hybridization to [ P]dATP- or digoxigenin-labeled falciparum culture immediately before mosquito feeding; a (Boehringer Mannheim) RT-PCR fragments.