RESEARCH ARTICLE Efficient Gene Knockdown in Mouse Oocytes through Peptide Nanoparticle-Mediated SiRNA Transfection Zhen Jin, Ruichao Li, Chunxiang Zhou, Liya Shi, Xiaolan Zhang, Zhixia Yang*, Dong Zhang* State Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing, Jiangsu, China * [email protected] (DZ); [email protected] (ZXY) Abstract The use of mouse oocytes as a model for studying female meiosis is very important in repro- ductive medicine. Gene knockdown by specific small interfering RNA (siRNA) is usually the first step in the study of the function of a target gene in mouse oocytes during in vitro matura- tion. Traditionally, the only way to introduce siRNA into mouse oocytes is through microin- OPEN ACCESS jection, which is certainly less efficient and strenuous than siRNA transfection in somatic Citation: Jin Z, Li R, Zhou C, Shi L, Zhang X, Yang cells. Recently, in research using somatic cells, peptide nanoparticle-mediated siRNA Z, et al. (2016) Efficient Gene Knockdown in Mouse transfection has been gaining popularity over liposome nanoparticle-mediated methods Oocytes through Peptide Nanoparticle-Mediated because of its high efficiency, low toxicity, good stability, and strong serum compatibility. SiRNA Transfection. PLoS ONE 11(3): e0150462. doi:10.1371/journal.pone.0150462 However, no researchers have yet tried transfecting siRNA into mouse oocytes because of the existence of the protective zona pellucida surrounding the oocyte membrane (vitelline Editor: Qing-Yuan Sun, Institute of Zoology, Chinese Academy of Sciences, CHINA membrane). We therefore tested whether peptide nanoparticles can introduce siRNA into mouse oocytes. In the present study, we showed for the first time that our optimized pro- Received: December 4, 2015 gram can efficiently knock down a target gene with high specificity. Furthermore, we Accepted: February 15, 2016 achieved the expected meiotic phenotypes after we knocked down a test unknown target Published: March 14, 2016 gene TRIM75. We propose that peptide nanoparticles may be superior for preliminary func- Copyright: © 2016 Jin et al. This is an open access tional studies of unknown genes in mouse oocytes. article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Introduction Data Availability Statement: All relevant data are within the manuscript. Gene knockdown through RNA interference is one of the most popular and powerful tools in cell biology studies. Diverse standardized protocols using double-stranded RNA (500–600 bps) Funding: This work was supported by the National [1], short hairpin RNA (shRNA, 23–29 bps) [2], or small interfering RNA (siRNA, 21–23 bps) Basic Research Program of China (973 Program; Grant No: 2013CB945504, http://program.most.gov. [3] are optimized and used for different cell types. Among these, nanoparticle-mediated siRNA cn/); General Program of the National Natural transfection is the most widely used. In recent years, multiple genome-wide studies have identi- Science Foundation of China (Grant No: 31271441 fied many new candidates involved in certain important biological processes by virtue of this and 31471406; http://isis.nsfc.gov.cn). technique [1–3]. Nanoparticles, also known as ultrafine particles, have a diameter of <100 nm. Competing Interests: The authors have declared According to their structural composition, nanoparticles are liposome-based [4] or peptide- that no competing interests exist. based [5–6]. Recently, peptide-based nanoparticles have been increasingly replacing liposome- PLOS ONE | DOI:10.1371/journal.pone.0150462 March 14, 2016 1/11 Peptide Nanoparticle-Mediated Gene Knockdown in Mouse Oocytes based nanoparticles for introducing siRNA into cells owing to their high efficiency, low toxic- ity, good stability, and strong serum compatibility [5–6]. The mouse oocyte is a good cell model for female meiosis studies that will eventually con- tribute to human eugenics. However, less information is known about meiosis than mitosis (in Pubmed, 5.7% vs 15.6% in all cell cycle studies). One unfavorable factor is that it is more diffi- cult and strenuous to collect mouse oocytes; the other major one is that microinjection has to be employed for silencing a target unknown gene through specific siRNA in mouse oocytes [7– 8]. This is because the zona pellucida around the oocyte membrane (vitelline membrane) can almost completely block the direct uptake of siRNA, entry of lentivirus-mediated shRNA vec- tor, or transfection of liposome nanoparticle-based siRNA [9]. Until now, no research has tested whether peptide nanoparticle-mediated siRNA transfection can be a feasible tool for gene knockdown in mouse oocytes. Our laboratory is devoted to establishing a standardized and highly operable method for gene knockdown in mouse oocytes through siRNA transfection instead of microinjection. After many trials with several commercial peptide nanoparticle transfection reagents, we have successfully selected the most appropriate reagent that can knock down genes in a highly effi- cient manner as well as with very low toxicity [10–11]. Materials and Methods General chemicals & reagents and animals Chemicals & reagents were obtained from Sigma unless otherwise stated. 3~4 week-old female ICR mice used in this study were from Vitalriver experimental animal technical co., LTD of Beijing. All animal experiments were approved by the Animal Care and Use Committee of Nanjing Medical University (approval No:14030158) and were performed in accordance with institutional guidelines. Prior to oocyte collection (usually 1~3 days), mice were temporarily kept in SPF-level clean room in the animal core facility of Nanjing Medical University. Antibodies Mouse monoclonal anti-β-actin (Cat#: A5316-100) was purchased from Santa Cruz (St. Louis, MO, USA). Rabbit polyclonal anti-trim75 (Cat#: sc-249091) was purchased from Santa Cruz (Dallas, Texas, USA). Mouse monoclonal anti-β-tubulin antibody (Cat#: sc-5274) antibody was purchased from Santa Cruz (Dallas, Texas, USA). Human anti-centromere CREST anti- body (Cat#:15–234) was purchased from Antibodies Incorporated (Davis, CA, USA). Cy2-conjugated donkey anti-mouse IgG (Code:715-225-150), rhodamine(TRITC)-conjugated donkey anti-goat IgG (Code:705-025-147), and 647-conjugated donkey anti-Human IgG (Code:709-605-149) were purchased from Jackson ImmunoResearch Laboratory (West Grove, PA, USA). Horseradish Peroxidase (HRP)-conjugated rabbit anti goat IgG and HRP-conju- gated goat anti mouse IgG were purchased from Vazyme (Nanjing, jiangsu, China). Oocytes collection and culture For oocyte collection, we always picked female ICR mice in natural estrus instead of applied super ovulation. Usually 20–50 immature oocytes arrested in prophase I (GV oocytes) could be obtained from the ovaries of each mouse. Exact numbers of oocytes used in each experiment were included into corresponding figures. The mice were sacrificed by cervical dislocation and ovaries were isolated and placed in operation medium (Hepes) with 2.5 μM milrinone and 10% fetal bovine serum (FBS) (Gibco). Oocytes were released from the ovary by puncturing the folli- cles with a hypodermic needle. Cumulus cells were washed off the cumulus-oocyte complexes PLOS ONE | DOI:10.1371/journal.pone.0150462 March 14, 2016 2/11 Peptide Nanoparticle-Mediated Gene Knockdown in Mouse Oocytes and every 50 Isolated denuded oocytes were placed in 100-ul droplets of culture medium under mineral oil in plastic dishes (BD). The culture medium was MEM+ (MEM with 0.01mM EDTA, 0.23mM Na-pyruvate,0.2mM pen/sterep, 3mg/ml BSA and 20% FBS). Oocytes were cultured at in vitro 37.0°C, 5% O2, 5% CO2 in humidified atmosphere. Prior to maturation (IVM), all cul- ture medium include 2.5 μM milrinone to prevent resumption of meiosis. Particularly, two dif- ferent sorts of Gibco FBS were used in this study: for all siRNA related experiments, we used Performance Plus grade FBS (Cat No: 16000–044; Endotoxin 5 EU/ml, Hemoglobin 10 mg/ dl); for all other experiments, we used Secure grade FBS (Cat No: 16000–044; Endotoxin 10 EU/ml, Hemoglobin 25 mg/dl) that is being widely used in regular cell culture. SiRNA production and transfection Sequences of all DNA templates for siRNA production are listed in Table 1. The sequence of control templates is a mock sequence that does not specifically bind to any mRNA from the mouse genome. DNA templates against four different coding for DNA sequence (CDS) regions of TRIM75 siRNA were designed online through BLOCK-iT™ RNAi Designer (http:// rnaidesigner.invitrogen.com/rnaiexpress/) with some modification. Sequence specificity was verified through a blast homology search. Table 1. DNA oligos for siRNA production. Target Site DNA templates 437–4611 Oligo1: GGATCCTAATACGACTCACTATAGCAAGCTCCTGAAGTGGGAAGTGAA2 437–4611 Oligo2:AATTCACTTCCCACTTCAGGAGCTTGCTATAGTGAGTCGTATTAGGATCC2 437–4611 Oligo3: GGATCCTAATACGACTCACTATATTCACTTCCCACTTCAGGAGCTTGC2 437–4611 Oligo4:AAGCAAGCTCCTGAAGTGGGAAGTGAATATAGTGAGTCGTATTAGGATCC2 631–6341 Oligo1: GGATCCTAATACGACTCACTATAGAGAAGAGACTGCTTGATAACATA2 631–6341 Oligo2:AATATGTTATCAAGCAGTCTCTTCTCTATAGTGAGTCGTATTAGGATCC2 631–6341 Oligo3: GGATCCTAATACGACTCACTATATATGTTATCAAGCAGTCTCTTCTC2 631–6341 Oligo4:AAGAGAAGAGACTGCTTGATAACATATATAGTGAGTCGTATTAGGATCC2 718–7421 Oligo1: GGATCCTAATACGACTCACTATAGAGCTCTCCGAAGCCAAGATGTTGT2 718–7421 Oligo2:AAACAACATCTTGGCTTCGGAGAGCTCTATAGTGAGTCGTATTAGGATCC2