ONCOLOGY LETTERS 9: 2463-2470, 2015 Expression changes of cell‑cell adhesion‑related genes in colorectal tumors MATEUSZ BUJKO1, PAULINA KOBER1, MICHAL MIKULA2, MARCIN LIGAJ3, JERZY OSTROWSKI2 and JANUSZ ALEKSANDER SIEDLECKI1 Departments of 1Molecular and Translational Oncology, 2Genetics and 3Pathology, Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology, Warsaw 02-781, Poland Received September 10, 2014; Accepted February 10, 2015 DOI: 10.3892/ol.2015.3107 Abstract. Epithelial tissues achieve a highly organized patterns appear to be consistent among patients with cancer structure due to cell-cell junction complexes. Carcinogenesis and adenoma, in addition to normal mucosa samples. is accompanied by changes in cell interactions and tissue morphology, which appear in the early stages of benign Introduction tumors and progress along with invasive potential. The aim of the present study was to analyze the changes in expression Epithelial tissue is fundamental to the physiology of organ- levels of genes encoding intercellular junction proteins that isms. Maintenance of its complex architecture and function have been previously identified to be differentially expressed requires strict spatial and temporal coordination of various in colorectal tumors compared with normal mucosa samples processes (1). Loss of control over the cell cycle, migration (fold change, >2.5) in genome‑wide expression profiling. The and adhesion results in the deregulation of normal tissue func- expression of 20 selected genes was assessed using quantitative tion, and may lead to the development of epithelium-related reverse transcription polymerase chain reaction in 26 colorectal diseases, including cancer (2). Adhesion molecules are cancer, 42 adenoma and 24 normal mucosa samples. Between therefore of significance in the study of tumor progression, these tissue types, differences were observed in the mRNA particularly due to their contribution to signal transduction levels of genes encoding adherens junction proteins (upregula- and cell communication, in addition to adhesion (2-6). tion of CDH3 and CDH11, and downregulation of CDH19 and Epithelial tissues achieve their highly organized structure PTPRF), tight junction proteins (upregulation of CLDN1 and through cell-cell junction complexes. Four main types of CLDN2, and downregulation of CLDN5, CLDN8, CLDN23, cell‑cell junctions have been identified, which form areas of CLDN15, JAM2 and CGN) and desmosomes (upregulation of contact between cells: Adherens junctions, desmosomes, tight DSC3 and DSG3, and downregulation of DSC2), in addition to junctions and gap junctions (2,5). a decrease in the expression of certain other genes involved in Adherens junctions and desmosomes are anchoring-type intercellular connections: PCDHB14, PCDH7, MUPCDH and junctions, which hold cells together allowing them to form NEO1. The differences between tissue types were statistically certain complex structures. The junctions are formed predom- significant, and separate clustering of normal adenoma and inantly by interactions between the extracellular domains of carcinoma samples was observed in a hierarchical clustering transmembrane cadherin proteins, which are also anchored to analysis. These results indicate that the morphological changes the cytoskeleton (3). Tight junctions (or occluding junctions) in neoplastic colon tissue that occur during the ‘adenoma-carci- function as selective barriers for ions and molecules, control- noma sequence’ are accompanied by specific changes in the ling their passage through adjacent cells. Tight junctions are expression of multiple genes encoding the majority of cell-cell critical for maintaining cell polarity, and are localized near junction complexes. The particular differential expression the apical membrane of the cell (4,6). These junctions are maintained primarily by transmembrane proteins including occludin and a variety of claudins (4,6). Gap junctions are channels made of connexins, which allow cells to communicate via the direct flow of inorganic ions and small water‑soluble Correspondence to: Mr. Mateusz Bujko, Department of Molecular and Translational Oncology, Maria Sklodowska-Curie Memorial molecules between the cytoplasm of neighboring cells (5). Cancer Center and Institute of Oncology, 5 W.K. Roentgena, Colorectal adenocarcinoma (AC) is among the most Warsaw 02-781, Poland common malignancies worldwide, accounting for the E-mail: [email protected] diagnosis of >1.2 million cases and >600,000 mortalities, annually (7). According to the generally accepted model, Key words: colorectal cancer, colorectal adenoma, gene expression, it develops from the mucosa of colonic crypts through the cell-cell adhesion stage of benign adenoma (AD). The neoplastic progression from colonic mucosa to invasive tumor is accompanied by distinct molecular alterations and changes in morphological 2464 BUJKO et al: CELL-CELL ADHESION GENES IN COLORECTAL CANCER AND ADENOMA tissue characteristics, known as the ‘adenoma-carcinoma Table I. Patient characteristics and sample description. sequence’ (1). This involves conformational changes, loss or disruption of cell adhesion and increased cell mobility. These A, Cancer patients n changes appear in the early stages of benign adenomas, and progress concurrently with the invasive potential of tumors. Patients, n 26 They are also features of the epithelial-mesenchymal transi- Gender, n tion phenomenon, which is crucial for the development of Male 11 invasive phenotypes. Dissociation of cell-cell junctions is an Female 15 important element of these processes (3,8). Age, years Genes encoding proteins involved in intercellular adhesion Range 38-81 are differentially expressed between normal colonic mucosa Median 64 and neoplastic epithelia of adenoma and cancer. In the present Astler-Coller stage, n study, quantitative reverse transcription polymerase chain B1 4 reaction (qPCR) was used to assess the expression levels of B2 15 20 genes encoding cell-cell adhesion-related proteins with C2 7 the greatest difference in expression levels between normal Tumor location, n and tumor tissue. Candidate genes were selected based on Caecum 4 the results of previous microarray transcriptome profiling of Ascending 7 normal and neoplastic colorectal tissues (9). Transverse 1 Descending 2 Materials and methods Sigmoid 6 Rectum 6 Patients. Fresh frozen tumor tissue samples were obtained from Carcinoma content, % 26 cancer patients, with 15 samples of corresponding normal Range 51-98 colonic (NC) mucosa sections, and 42 colorectal adenoma Median 75.5 samples. Clinical tissue sample sections were collected at the Maria Sklodowska-Curie Memorial Cancer Center and Insti- B, Adenoma patients tute of Oncology (Warsaw, Poland) upon the agreement of the ethics committee of the Maria Sklodowska-Curie Memorial Patients, n 42 Cancer Center and Institute of Oncology and written informed Gender, n consent was obtained from each patient. Male 25 AC tissue and adjacent normal colon tissue were obtained Female 17 following surgical resection through laparotomy. NC sections were collected from a distance of >5 cm from the tumor tissue. Age, years Colonic AD samples were obtained during colonoscopic Range 41-83 polypectomy. Samples of normal mucosa from nine healthy Median 60 individuals were also collected during colonoscopy. Tissue Adenoma size, mm samples were snap frozen in liquid nitrogen and stored Range 9-50 at ‑80˚C. Cryostat sections were prepared for each specimen Median 15 using a Microm HM 505E (Zeiss, Oberkochen, Germany) and Histopathology, n upper and lower sections from each cryosection collection Tubular adenoma 29 were evaluated by a pathologist to control the relative cell type Tubulovillous adenoma 13 content. Patient characteristics are shown in Table I. Polyp location, n Caecum 3 Assessment of gene expression levels. A total of 20 genes Ascending 1 encoding molecules involved directly in cell-cell adhesion Transverse 6 were selected, based on annotation in the Gene Ontology Descending 2 (GO) database and a literature search of the PubMed database. Sigmoid 25 Genes that exhibited a fold change (FC) in expression of >2.5 Rectum 5 between normal and tumor tissue, and reached a significance Adenoma content, % threshold (adjusted P-value <0.05), based on previous micro- Range 50-99 array analyses, were included (9). Median 90 Total RNA from tissue samples was isolated with the use of RNeasy Mini (Qiagen, Hilden, Germany). From each tissue C, Normal mucosa samples sample, 1 µg of RNA was subjected to reverse transcription with SuperScript II Reverse Transcriptase (Invitrogen Life Samples, n Technologies, Carlsbad, CA, USA). qPCR was conducted in Total 24 384 well plates using an Applied Biosystems 7900HT Fast From cancer patients 15 Real-Time PCR System (Applied Biosystems Life Technolo- From healthy individuals 9 gies, Foster City, CA, USA) with Sensimix SYBR kit (Bioline ONCOLOGY LETTERS 9: 2463-2470, 2015 2465 Table II. Primer sequences used in quantitative real-time polymerase chain reaction. Gene symbol Forward primer, 5'-3' Reverse primer, 5'-3' CDH3 CAGTGCTAAACAGAGCTGGC AGGCTGAAGTGACCTTGGAG CDH11 CAGCAGAAATCCACAATCGG CTTCATAAGGGGCAGCAAAC CDH19 TGATTCCCTCCAGACCTACG AGCGAGGTCCCAACTCATTA PTPRF CTTCTCCACCACCTTCAGC GCCTGGGTGAGATCAACACT DSC2 CTGACCCTCGCGATCTTA TTGCAGCTGTAAAGCACTCT DSC3 GACCCTCGTGATCTTCAGTC ACCTGAAGCACTCTTCCAAA DSG3 CCATCTTCGTGGTGGTCATA CCCATTCACGTTTTTGCCTT CLDN1 CTTCTTGCAGGTCTGGCTAT AGAGCCTGACCAAATTCGTA CLDN2 GGTTGAATTGCCAAGGATGC TGAGTCCTGGCTTAAGGGAA