BASICS OF MOLECULAR DIAGNOSTICS FOR THE EVERYDAY PRACTICING PATHOLOGIST Artur Rangel, MD, PhD Pathology Consultants of South Broward Medical Director, Clinical and Molecular Pathology - Memorial Healthcare System Genome Structure ____________________________________Start Stop |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT |||||||||||||||||||||||||||||||||||| Common Types of Genetic Variants Chromosomal GAINS / LOSSES (CNV) Complete vs Partial Large translocations Balanced vs unbalanced 1p / 19q Co-deletion Oligodendroglioma 1p 19q 1p / 19q Co-deletion Oligodendroglioma 250,000,000 bp Technique: Karyotype Variants GAINS / LOSSES / Rearrangements Resolution Chromosome level / Megabases Scope Genome wide Quantitative Semi ( x / 20 cells) Specimen Requires living / dividing cells Limitations Specimen / resolution Common Types of Genetic Variants Sub-chromosomal GAINS / LOSSES (CNV) Several kilobases range Small Translocations Balanced vs unbalanced Genome Structure DNA Complementarity A <–> T G <–> C DNA Complementarity -> hybridization DNA Hybridization DNA Complementarity -> hybridization DNA Complementarity -> hybridization DNA Complementarity -> hybridization Millions of Bases Thousands of Bases 22 22 Break apart probe Karyotype FISH Karyotype FISH Technique: FISH Variants GAINS / LOSSES / Rearrangements Resolution Sub-Chromosome / 100’s Kilobases Scope Targeted – specific probes Quantitative Yes, % affected cells Specimen FFPE or dividing cells (metaphase) Limitations Specimen / Decal / resolution Common Types of Genetic Variants Chromosomal GAINS / LOSSES (CNV) Complete vs Partial Single Nucleotide Polymorphisms (SNP) Gene Expression Over, Under Expression profiling Microarray Applications Comparative Genomic Hybridization - array CGH Gene Expression Profiling Single Nucleotide Polymorphism - SNP array Microarray Microarray CTTAACCG s Microarray CTTAACCG CTTAACCG CTTAACCG CTTAACCG Microarray - CGH Patient Control ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT G G CC CC AA AA G TT TT C CC C AA G TT G C CC CC AA AA TT TT C C Microarray - CGH Patient Control ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT G G CC CC AA AA G TT TT C C CC AA G G TT CC C CC AA AA TT TT C C Patient DNAPatient Normal Patient Normal CTTAACCG CTTAACCG CTTAACCG CTTAACCG Control DNA Control Microarray - Copy Number Variation (CNV) Variation Copy Number - Microarray Normal Patient Normal CTTAACCG CTTAACCG CTTAACCG CTTAACCG Patient DNA Patient +4 copies Fold +4copies change: 3 / / CNV:6 CTTAACCG CNV : GAIN CNV: CTTAACCG CTTAACCG CTTAACCG Control DNA Control +4 copies /Fold +4 copies change: 3 / CNV:6 CNV : GAIN CNV: CTTAACCG CTTAACCG CTTAACCG CTTAACCG Patient DNA Patient -1 copy / Fold change: copy-1/ change: 0.5/ CNV:1 Fold CTTAACCG CTTAACCG LOSS CNV: CTTAACCG CTTAACCG CTTAACCG CTTAACCG Control DNA Control -1 copy / Fold change: copy -1/ Fold change: 0.5/ CNV:1 CNV : LOSS CNV: CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG Microarray Variations Comparative Genomic Hybridization - array CGH Gene Expression Profiling Single Nucleotide Polymorphism - SNP array Microarray Applications Expression Profiling Gene Expression ______Start ______________________________Stop DNA |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT |||||||||||||||||||||||||||||||||||| Gene Expression ______Start ______________________________Stop DNA |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA UACUGCCUAGUCGGCGUUCGCCUUAACCGCUGUAUU mRNA |||||||||||||||||||||||||||||||||||| exon 1 intron exon 2 intron exon 3 spliced UACUGCCGUUCGCCUUCUGUAUU ||||||||||||||||||||||| mRNA exon 1 exon 2 exon 3 cDNA TACTGCCGTTCGCCTTCTGTATT ||||||||||||||||||||||| mRNA UACUGCCGUUCGCCUUCUGUAUU ||||||||||||||||||||||| cDNA TACTGCCGTTCGCCTTCTGTATT ||||||||||||||||||||||| cDNA Probes CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG Profiling Expression Gene Microarrays Variations Microarrays CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG CTTAACCG Microarray Variations Comparative Genomic Hybridization - array CGH Gene Expression Profiling Single Nucleotide Polymorphism - SNP array Single Nucleotide Polymorphisms G C A * CGTT AGA SNP array SNP Target Target SNP Comp. DNA DNA Comp. CGTTGCAATCT * (A,G,T) CGTCGCAATCT G C C G A T * * C G G C TT AA CGT GCAATCT A A T G C A T GCA CGTTAGA A A CGTTGCAATCT DNA Patient GCAACGTTAGA Patient Genotype at Genotype Patient G CGTCGCAATCT G G C C A A A A C T C G CGTAGCAATCT G TT TT A A G * G A A : : AA A A / G A T A CGTTGCAATCT DNA Patient GCAACGTTAGA Patient Genotype at Genotype Patient G CGTCGCAATCT G G C C A A T A C T C G CGTAGCAATCT G TT GCATCGTTAGA TT A A G * G A A : : A A T A / G T T Technique: Microarrays Variants CNV, SNP, Gene Expression Resolution SNP to 10’s Kilobases Scope Targeted / genome wide Quantitative Yes, CNV /Expression Specimen Blood, Fresh, Frozen, FFPE, cells Limitations Balanced alterations / Decal Common Types of Genetic Variants Single Nucleotide Polymorphisms (SNP) Insertions / Deletions (InDel) Fusions (translocations) CNV Gene Expression Polymerase Chain reaction - PCR ______Start ______________________________Stop DNA |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT |||||||||||||||||||||||||||||||||||| ______Start ______________________________Stop |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGGCGTTCGCCTT AACCGCTGTATT for primer |||||||||||||||||||||||| |||||||||||| ||||||| _____________________________ ||||||||||||||||||||||||||||| AATACAG ATGACGGATCAGCCGCAAGCGGAATTGGC rev primer TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT |||||||||||||||||||||||||||||||||||| ______Start ______________________________Stop |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA CTAGTCGGCGTTCGCCTTAACCGCTGTATT |||||||||||||||||||||||||||||| _____________________________ ||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGC TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT |||||||||||||||||||||||||||||||||||| Polymerase Chain reaction - PCR Typical 35 cycle PCR => 2^35 ~ 34 Billion fold amplification PCR - Results Gel electrophoresis Capillary electrophoresis Quantitative PCR Gel electrophoresis Capillary Electrophoresis ______Start ______________________________Stop |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGC |||||| TACTGCCTAGTCGGCGTTCGCCTTAACCGCTGTATT |||||||||||||||||||||||||||||||||||| qPCR – Quantitative PCR Quantitative PCR ______Start ______________________________Stop |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCCTAGTCGG CCGGTTTTCCGGCCCCTTTT |||||||||||||| |||||||||||||||||||| Technique: PCR applications Variants typing (SNP, InDel), CNV, Expression Resolution SNP to 100’s of bases Scope Targeted Quantitative Yes: qPCR (CNV /Expression) Specimen Blood, Fresh, Frozen, FFPE, cells Limitations Targeted / Resolution / Decal ______Start ______________________________Stop Sanger Sequencing |||||||||||||||||||||||||||||||||||| ATGACGGATCAGCCGCAAGCGGAATTGGCGACATAA TACTGCC* ||||||| TACTGCCT* |||||||| TACTGCCTA* ||||||||| TACTGCCTAG* |||||||||| TACTGCCTAGT* ||||||||||| Technique: Sanger Sequencing Variants Novel (SNP, InDel) Resolution SNP to 100’s of bases Scope Limited Targeted Quantitative No, LOD ~20% VAF Specimen Blood, Fresh, Frozen, FFPE, cells Limitations Targeted / low throughput/ LOD / Decal Next Generation Sequencing - NGS Not meant for humans CNV - Gain Control Patient CNV - Loss Control Patient CNV by NGS Fusions by NGS EWSR1 (22q12.2) WT1 (11p13) FISH Break Apart 22 22 Technique: NGS Sequencing Variants Novel (SNP, InDel, CNV, Fusions) Resolution SNP to 100’s of bases Scope Targeted to genome wide Quantitative Yes: SNP, CNV, InDel / LOD 1-5% VAF Specimen Blood, Fresh, Frozen, FFPE, cells Limitations CNV sensitivity / Decal / Data Intense Pathologist’s Roles CLIA validation Molec Tissue assessment AP + Molec Test / Panel selection AP + Molec + onc Data analysis Molec Clinical report Molec Tertiary analysis - Accurate variant inclusion Somatic (tumor) mutations Read depth Limit of detection LOD (analytical sensitivity) Variant Allele Fraction (VAF) Interpretation Read depth 20 12 ● Measure of consensus accuracy ● Acceptable ~>200 ● Usually depth of coverage is in the thousands for a standard run Variant Allele Fraction (VAF) .............................. .............................. Reference Human genome 6/20 = 30% VAF in sample Variant allele fraction (VAF) Pure Tumor Gene VAF 50% 50% Tumor Gene Gene VAF 25% 20% Tumor VAF 10% 10% Tumor VAF 5% LOD analytic sensitivity 5% ● Variant allele fraction at which 95% of samples would reliably be detected ● Usually 1-5% allele frequency ● "Noise" vs. true allele ○ Polymerase errors ○ Deamination ○ DNA oxidative damage LOD 5% 55% overcall It’s All About Nuclei Pitfalls... Pitfalls: Necrosis Pitfalls: Necrosis Pitfalls: Mucinous CA Pitfalls: Mucinous CA Pitfalls: Mucinous CA http://www.pathologyoutlines.com Pitfalls: Lymph nodes Pitfalls: Melanin https://en.wikipedia.org/wiki/Melanoma Tumor Enrichment 4x Low Power Field Tissue Selection: Size .