October 2006 Structural studies on DNA G-quadrupIexes Sarah Wallace Burge {née Rankin) A thesis submitted for the degree of Doctor of Philosophy of the University of London Cancer Research UK Biomolecular Structure Group The School of Pharmacy University of London ProQuest Number: 10104293 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest 10104293 Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 Acknowledgements This work is in part a testament to the advice and encouragement I have received from various quarters over the past three years. They are too numerous to include and these brief mentions are somewhat inadequate to express my gratitude for their forbearance, wisdom and friendship. My supervisor, Professor Stephen Neidle, provided excellent direction and advice which resulted in a fulfilling and productive three years. I extend my thanks also to Dr Gary Parkinson for his advice and to Dr Mire Zloh for his assistance with NMR data collection at the School of Pharmacy. The hospitality of Dr Anh Tuan Phan and Professor Dinshaw Patel at the Memorial Sloan Kettering Cancer Center, New York, made for a truly memorable visit; I am indebted to them for their assistance in the synthesis of the '^N labelled DNA and collection of the associated NMR spectra. I am also grateful to Dr Shankar Balasubramanian at the Department of Chemistry, University of Cambridge for use of a circular dichroism spectrometer. The members of the Cancer Research Biomolecular Structure Group, both past and present, made working at the School of Pharmacy a rewarding and enjoyable time. In particular I would like to thank Irene Dougherty for her superb assistance throughout the past three years. To Peter, with all my love. Abstract Guanine-rich lengths of DNA are capable of self-assembly into higher order structures known as G-quadruplexes. Guanine rich DNA sequences from a range of biologically relevant regions in the human genome, most notably telomeric DNA, have been observed to form such structures. To date a wide variety of quadruplex structures have been experimentally determined. This thesis is primarily concerned with the characterisation of a G-rich region of DNA from the c-kit oncogene promoter region. This work investigates the ability of this sequence, d(AGGGAGGGCGCTGGGAGGAGGG) (known as c-kit 7), to form quadruplex structures using a range of biophysical techniques, principally nuclear magnetic resonance, UV melting studies and CD spectroscopy. The structural and thermodynamic properties of a quadruplex forming from this sequence are comprehensively examined. G-quadruplexes are known to be sensitive to small mutations in their loop regions and a series of three mutated sequences was created with the aim of elucidating the effects of mutations on the quadruplex forming ability of this region of G-rich DNA. The effect of each mutation was examined using the biophysical methods outlined above. Molecular dynamics simulations have also been performed to investigate three different quadruplex topologies that this sequence may adopt in the solution phase. Free-energy calculations were undertaken to investigate the relative stabilities of the possible folds. The molecular dynamics simulations also provide an insight into the behaviour of the loop regions for a range of possible loop topologies. Ligand interaction with a model of the parallel c-kit 1 quadruplex was also studied by molecular dynamics in order to provide a structural rationale for ligand binding. A range of acridine-based ligands were studied and the model was validated by comparison with experimentally observed binding affinities. Modelling studies were also undertaken to examine the relative behaviour of two human telomeric quadruplex structures. Results show that the c-kit 1 sequence is capable of forming a single quadruplex species with a novel parallel motif. The sequence is highly sensitive to mutation; modified sequences do not show any quadruplex forming ability. Modelling studies on the human telomeric quadruplex folds reveal that base pairing contributes significantly to the overall stability of the 3-1-1 fold. The availability of these bases to participate in pairing interactions in vivo may determine the viability of the mixed fold in a cellular environment. 3 Table of Contents Acknowledgements............................................................................................................................2 Abstract .................................................................................................................................................3 List of Figures and Tables ................................................................................................................8 Abbreviations....................................................................................................................................13 Chapter 1. Introduction.................................................................................................................. 15 1.1 Guanine quadruplexes .............................................................................................................15 1.1.1 Tetra-, bi-and unimolecular quadruplexes ..................................................... 17 1.2 Telomeric G-quadruplexes .....................................................................................................19 1.2.1 Structure o f telomeric quadruplexes ................................................................. 20 1.3 Factors affecting quadruplex stability and topology ..........................................................26 1.3.1 Nature o f the metal ion ....................................................................................... 26 1.3.2 Sequence effects ....................................................................................................27 1.3.3 Loop lengths and sequences...............................................................................28 Chapter 2. Non-telomeric quadruplexes and the c-kit oncogene......................................... 31 2.1 Non telomeric quadruplexes in biology ...............................................................................31 2.2 G-quadruplexes in the c-myc oncogene ...............................................................................32 2.2.1 Structure o f the c-myc quadruplexes ................................................................ 34 2.3 Formation of G-quadruplex structures in vivo.................................................................... 36 2.4 Quadruplex - interacting ligands ..........................................................................................37 2.4.1 Ligands interacting with telomeric quadruplex DNA .....................................38 2.5 The c-kit oncogene ..................................................................................................................40 2.5.1 Protein kinases .....................................................................................................41 2.5.2 The c-kit promoter region ................................................................................... 43 2.5.3 The c-kit G-rich sequences and scope o f this work. ........................................ 44 Chapter 3. Establishing quadruplex formation within the c-kit oncogene promoter region...................................................................................................................................................47 3.1 Background ..............................................................................................................................47 3.2 UV melting point experiments ..............................................................................................47 3.3 Circular dichroism methods .................................................................................................. 50 3.3.1 Scope o f work in this chapter ..............................................................................51 3.4 Materials and methods ........................................................................................................... 51 3.4.1 DNA synthesis and preparation ......................................................................... 51 3.4.2 UV melting absorbance spectra ......................................................................... 52 3.4.3 Circular dichroism spectra .................................................................................52 3.5 Results.......................................................................................................................................53 3.5.1 UV Melting curves o f the native sequence ....................................................... 53 3.5.2 Circular dichroism results for the native sequence ........................................ 57 3.5.3 UV melting curves and CD spectra for the modified sequences................... 57 3.6 Discussion ................................................................................................................................60