Neurosci. Bull. October, 2019, 35(5):877–888 www.neurosci.cn https://doi.org/10.1007/s12264-019-00361-0 www.springer.com/12264 ORIGINAL ARTICLE Circular HDAC9/microRNA-138/Sirtuin-1 Pathway Mediates Synaptic and Amyloid Precursor Protein Processing Deficits in Alzheimer’s Disease 1 2 1 Yanjun Lu • Lu Tan • Xiong Wang Received: 2 September 2018 / Accepted: 12 December 2018 / Published online: 18 March 2019 Ó Shanghai Institutes for Biological Sciences, CAS 2019 Abstract Synaptic dysfunction and abnormal processing circHDAC9 was decreased in the serum of both AD of amyloid precursor protein (APP) are early pathological patients and individuals with mild cognitive impairment. features in Alzheimer’s disease (AD). Recently, non- These results suggest that the circHDAC9/miR-138/Sirt1 coding RNAs such as microRNAs (miRNAs) and circular pathway mediates synaptic function and APP processing in RNAs (circRNAs) have been reported to contribute to the AD, providing a potential therapeutic target for its pathogenesis of AD. We found an age-dependent elevation treatment. of miR-138 in APP/PS1 (presenilin-1) mice. MiR-138 inhibited the expression of ADAM10 [a disintegrin and Keywords Alzheimer’s disease Á Synapse Á Memory Á metalloproteinase domain-containing protein 10], pro- Sirtuin-1 Á microRNA Á Circular RNA moted amyloid beta (Ab) production, and induced synaptic and learning/memory deficits in APP/PS1 mice, while its suppression alleviated the AD-like phenotype in these Introduction mice. Overexpression of sirtuin 1 (Sirt1), a target of miR- 138, ameliorated the miR-138-induced inhibition of Alzheimer’s disease (AD) is a neurodegenerative disorder ADAM10 and elevation of Ab in vitro. The circRNA that is the most frequent cause of dementia, accounting for HDAC9 (circHDAC9) was predicted to contain a miR-138 60%–80% of all cases with dementia. The prevalence of binding site in several databases. Its expression was AD is 10% in people aged 65 and over, and increases to inversely correlated with miR-138 in both Ab-oligomer- 32% in those aged 85 and over [1]. The symptoms include treated N2a cells and APP/PS1 mice, and it co-localized a gradually worsening ability to remember new informa- with miR-138 in the cytoplasm of N2a cells. CircHDAC9 tion in the initial stage and an inability to communicate in acted as a miR-138 sponge, decreasing miR-138 expres- the advanced stage. The mechanism underlying AD sion, and reversing the Sirt1 suppression and excessive Ab remains unclear [2]. production induced by miR-138 in vitro. Moreover, Accumulating evidence indicates that non-coding RNAs (ncRNAs) are involved in AD, including microRNAs (miRNAs), long ncRNAs, piwi-interacting RNAs, and Yanjun Lu and Lu Tan have contributed equally to this work. circular RNAs (circRNAs) [3–5]. MiRNAs suppress target mRNA translation or induce mRNA decay via binding with & Xiong Wang 0 [email protected] seed sequences in the 3 -untranslated region of the target mRNA. Numerous dysregulated miRNAs in AD contribute 1 Department of Laboratory Medicine, Tongji Hospital, Tongji to the processing of amyloid precursor protein (APP), tau Medical College, Huazhong University of Science and phosphorylation, and synaptic plasticity [6, 7]. Technology, Wuhan 430030, China CircRNAs are a group of RNAs with covalently closed 2 Key Laboratory for Molecular Diagnosis of Hubei Province, loop structures, generated during splicing. A number of The Central Hospital of Wuhan, Tongji Medical College, Huazhong University of Science and Technology, conserved circRNAs are highly enriched in the mammalian Wuhan 430014, China brain, some of which are derived from synaptic genes and 123 878 Neurosci. Bull. October, 2019, 35(5):877–888 regulated depending on the developmental stage [8, 9]. Ethics Committee of Tongji Hospital approved the study Natural circRNAs function as miRNA sponges in the brain, and informed consent was given. providing potential novel therapeutic targets for AD treatment [8, 10]. Materials MiR-138 is a conserved miRNA that is enriched in the brain. It is increased in the cerebrospinal fluid (CSF) of AD Anti-APP antibody was from Abcam (Cambridge, UK), patients [11], acts as a potential regulator of memory anti-ADAM10 from Abcam, anti-BACE1 from Cell Sig- performance in humans, and negatively regulates dendritic naling Technology (Danvers, MA, USA), anti-b-actin from spine morphogenesis [12, 13]. Our previous study demon- Cell Signaling Technology (Danvers, MA, USA), anti- strated that miR-138 is increased in 12-month-old Tg2576 GAPDH from Proteintech (Wuhan, China), anti-sAPPb mice, N2a/APP cells, and HEK293/tau cells. Furthermore, from IBL (Fujioka-Shi, Gunma, Japan); and anti-Sirt1 from miR-138 promotes tau phosphorylation by targeting Cell Signaling Technology (Danvers, MA) or Proteintech retinoic acid receptor alpha [7, 14]. (Wuhan, China). The Ab42 ELISA kit was from Elab- Therefore we set out to determine the role of science (Wuhan, China), FISH kit from Bersinbio circHDAC9/miR-138/Sirt1 pathway in the synaptic, learn- (Guangzhou, China), RevertAid First Strand cDNA Syn- ing/memory, and APP processing deficits in AD. thesis Kit from Takara (Kusatsu, Shiga, Japan), miRNA Purification Kit from Cwbiotech (Beijing, China), RIPA lysis buffer from Beyotime (Shanghai, China), and HRP- Materials and Methods conjugated secondary antibody from Santa Cruz (Santa Cruz, CA, USA). The miR-138 mimic and agomir/an- Transgenic AD Mice tagomir and the scrambled control were from RiboBio (Guangzhou, China) and the miR-138-overexpressing con- Male APP/PS1 (APPswe and PSEN1dE9) transgenic mice struct was from GeneCopoeia (San Diego, CA, USA). The and control littermates were purchased from the Animal Sirt1 and APP plasmids were kindly gifted by Prof. Jianzhi Model Research Center of Nanjing University (Nanjing, Wang (Tongji Medical College, Huazhong University of Jiangsu, China). This work was approved by the Animal Science and Technology). The miR-138 mimic was from Care and Use Committee of Tongji Hospital, Tongji RiboBio (Guangzhou, China). Medical College of Huazhong University of Science and Technology. Stereotaxic Microinfusion Human Blood Samples Mice were anesthetized with chloral hydrate (400 mg/kg, intraperitoneal). Holes were drilled above the CA3 field of Ten amnestic patients with mild cognitive impairment the hippocampus (anterior/posterior ± 1.9 mm, medial/ (MCI) (7 males, 3 females; 70.20 ± 10.40 years old) and lateral ± 1.9 mm, dorsal/ventral 2.1 mm). Agomir seven AD patients (5 males, 2 females; 70.43 ± 5.08 years (350 nmol/L, 1.5 lL) or antagomir (600 nmol/L, 1.5 lL) old) diagnosed as previously described [15], were recruited was bilaterally microinfused into the hippocampus. from Tongji Hospital. A diagnosis of MCI included: (1) memory complaint; (2) clinical dementia rating 0.5; and (3) Morris Water Maze Test normal general cognitive function and daily life activities. A diagnosis of AD included: (1) the NINCDS-ADRDA The Morris water maze (MWM) was a deep pool criteria (National Institute of Neurological and Commu- (diameter: 120 cm, deep: 80 cm) filled with water made nicative Disorders and Stroke-Alzheimer’s Disease and opaque with milk. The pool was divided into four Related Disorders Association); (2) Mini-Mental State quadrants with a platform submerged 1 cm beneath the Examination score B 26; and (3) exclusion of brain tumor, surface in the target quadrant. Mice were trained for 5 vascular dementia, and cerebrovascular diseases. Ten consecutive days to find the platform (n = 12/group). A healthy individuals (7 males, 3 females; digital tracking device was used to measure movement. On 64.40 ± 12.69 years old) were recruited as a control group day 7, the platform was removed, and the crossing time and for the MCI patients, and another seven (4 males, 3 distance in the target quadrant (%) were recorded. females; 70.86 ± 4.11 years old) as controls for the AD patients. No statistically significant differences in age were Golgi Staining found between the MCI/AD and corresponding control groups. Serum was collected for RNA extraction. The Mice were anesthetized with chloral hydrate (400 mg/kg, intraperitoneal). After perfusion with normal saline and 4% 123 Y. Lu et al.: CircHDAC9/mRNA-138/Sirtuin-1 Pathway Mediates Synaptic and APP Processing 879 formaldehyde, brain tissue was immersed in 5% potassium Statistics dichromate, 4% formaldehyde, and 5% silver nitrate for one month. Slices were then cut on a vibrating microtome Data are shown as mean ± SD and analyzed with SPSS (Leica, Wetzlar, Germany). version 16.0 (SPSS Inc., Chicago, IL). The difference between two groups was analyzed with unpaired Student’s Fluorescence In situ Hybridization (FISH) t-test (two-tailed). The variance among multiple groups was analyzed with one-/two-way analysis of variance with/ The probes for circHDAC9 (green) and miR-138 (red) without repeated measures followed by the Bonferroni post were from Bersinbio (Guangzhou, China). N2a cells were hoc test. All experiments were performed three times, and harvested and fixed in 4% formaldehyde. The denatured P \ 0.05 was considered statistically significant. probes were hybridized with N2a cells for 20 h at 42 °C. Nuclei were stained with DAPI. The slices were observed under a fluorescence microscope (LSM800, Carl Zeiss, Results Darmstadt, Germany). Age-Dependent Elevation of miR-138 in APP/PS1 Real-Time Quantitative PCR Mice RNA was extracted with TRIzol reagent and reverse- The expression of miR-138 in the hippocampus of APP/ transcribed into cDNA. MiRNAs were isolated with a PS1 and control mice was assessed in 2-, 4-, and 5-month- miRNA purification kit. Real-time quantitative PCR was old mice. No difference in expression was found in performed with a SYBR Premix Dimer Eraser kit. Mouse 2-month-old APP/PS1 mice, while the miR-138 level circHDAC9: F, AGCAGTTCCTGGAGAAGCAG, R, GC increased to 1.6-fold in in the hippocampus of 4-month-old ATCTGTGTCTCGCACTTC; mouse ciRS7: F, ATGTTG and 2.4-fold in 5-month-old APP/PS1 mice relative to the GAAGACCTTGGTACTGGC, R, CCAACATCTCCACA control group (Fig.