379 Somatostatin receptor subtype expression in the human heart: differential expression by myocytes and fibroblasts William H T Smith, R Unnikrishnan Nair1, Dawn Adamson2, Mark T Kearney3, Stephen G Ball and Anthony J Balmforth Integrated Molecular Cardiology Group, University of Leeds, Leeds LS2 9JT, UK 1Department of Cardiothoracic Surgery, The General Infirmary at Leeds, Leeds LS1 3EX, UK 2National Heart and Lung Institute, Imperial College, London SW3 6LY, UK 3GKT School of Medicine, London WC2R 2LS, UK (Requests for offprints should be addressed to A J Balmforth; Email: [email protected]) Abstract In acromegaly, somatostatin receptor ligands (SRLs) can and sst5) were shown to be co-expressed by the human ameliorate left ventricular hypertrophy (LVH) and their heart. These receptors were present in both atrial and use is associated with demonstrable improvements in ventricular tissue. Human cardiac myocytes expressed various parameters of cardiac function. It remains unclear mRNA for only sst1 and sst2, while human cardiac as to whether these beneficial effects are principally fibroblasts expressed all four subtypes found in whole heart attributable to falling GH and IGF-I levels, or whether tissue. The expression of functional somatostatin receptors SRLs exert independent direct effects on the heart via on human cardiac fibroblasts was confirmed by mobilis- somatostatin receptors. To help address this issue, we have ation of intracellular calcium in response to somatostatin. sought to investigate somatostatin receptor expression The presence of cardiac somatostatin receptors raises the in human heart. A human heart cDNA library was possibility of a direct effect of somatostatin analogues on probed using PCR techniques to determine expression of the heart. Furthermore, the differential expression of somatostatin receptor subtypes. Subsequently, human somatostatin receptor subtypes by human cardiac myo- heart biopsies and human cardiac fibroblasts and myocytes cytes and fibroblasts opens up the possibility of differ- were analysed to determine whether expression differed ential modulation of the cell types in the heart by between cardiac chambers or cell types. mRNAs for four subtype-specific somatostatin analogues. of the five somatostatin receptor subtypes (sst1, sst2, sst4 Journal of Endocrinology (2005) 187, 379–386 Introduction complications of cardiac involvement in acromegaly (Clayton 2003). The coexistence of hypertension increases Acromegaly is a rare but important endocrine disorder the incidence of cardiac abnormalities (Colao et al. 2000a) associated with a reduced life expectancy. Subjects with and the risk of premature death (Holdaway et al. 2004). uncontrolled acromegaly have a 2- to 5-fold greater Treatment with the somatostatin receptor ligands mortality than controls, 60% of which is due to cardio- (SRLs) octreotide (Lim et al. 1992, Tokgozoglu et al. vascular disease (Wright et al. 1970, Orme et al. 1998). 1994, Colao et al. 2000b) and lanreotide (Baldelli et al. The main structural cardiac abnormality is left ventricular 1999, Manelli et al. 1999) has been shown to promote hypertrophy (LVH) (for review see Colao et al. (2001a)). regression of LVH with some studies also demonstrating LVH in acromegaly is characterised by both myo- improvements in left ventricular diastolic function cyte hypertrophy and a disproportionate accumulation of (Thuesen et al. 1989, Merola et al. 1993, Colao et al. fibrillar collagen (up to 8-fold greater than in biopsies 1999). It is worth noting, however, that while these results from patients with mitral stenosis (Frustaci et al. 1999). are encouraging, to date, no studies have been of sufficient Lymphomononuclear infiltration and areas of monocyte duration to establish whether normalising cardiac struc- necrosis resembling myocarditis have also been described ture ultimately translates into reduced cardiovascular mor- (Lie 1980). These changes are likely to account for the tality. In the meantime, therefore, we are dependent upon observed functional abnormalities of impaired left ven- demonstrating improvements in surrogate markers of tricular diastolic function, impaired exercise tolerance disease activity while the results of long-term follow-up and ventricular arrhythmias which are recognised studies are awaited. In this regard, treatment with SRLs is Journal of Endocrinology (2005) 187, 379–386 DOI: 10.1677/joe.1.06082 0022–0795/05/0187–379 2005 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org Downloaded from Bioscientifica.com at 09/28/2021 03:42:02PM via free access 380 W H T SMITH and others · Somatostatin receptor subtype expression in human heart effective in suppressing various markers of acromegalic Table 1 PCR primers used in reactions to detect somatostatin disease activity (Ezzat et al. 1992), which in turn has been receptor subtypes (5–3) associated with improved overall survival (Orme et al. 1998, Holdaway et al. 2004). Furthermore, improvements sst1 FP CGCTGGCTGGTGGGCTTCGTGTTG in exercise capacity (Padayatty et al. 1996) and cardiac sst1 RP CGCCGCCGGACTCCAGGTTCTCAG output in subjects with heart failure (Chanson et al. sst2 FP TCCAGGGTCCATTAAGGTGAGAA 1990) have been reported following octreotide therapy. sst2 RP TAGGGAGCCCATTGCCAGTAGAC Together these data have led some authors to suggest that sst3 FP CGTGGTGGGCCTGCTGGGTAACTC restoring cardiac structure and function should become an sst3 RP GTGCGGCCGTGTAGATGATGAAGC sst4 FP GTGTGGCTGGCATCCCTGTTGGTC objective of treatment in acromegaly (Clayton 2003). sst4 RP GATCGGCGGAAGTTGTCGGAGAGG Up until now it has generally been assumed that LVH sst5 FP TACATGCTGGGGCTGCCTTTCCTG regression in response to SRL therapy is mediated through sst5 RP GCCCGCCGCCCTCACCTTCAC the reduction in circulating growth hormone (GH) and insulin-like growth factor-I (IGF-I) levels (Colao et al. FP, forward primer; RP, reverse primer. 2001b). To our knowledge, no studies have so far sought to determine whether there is a direct cardiac effect of SRLs in the reversal of acromegaly-associated cardio- myopathy and its consequences. Morover, if such an effect for studies in human tissue if meaningful conclusions with was present, it would mandate further studies to explore direct relevance to clinical practice are to be drawn. its potential relevance in patients with pathological LVH In this study we have determined somatostatin receptor subtype expression at the mRNA level in the human of other causes such as hypertension. ff LVH is a frequent complication of hypertension with its heart. We have identified di erential receptor subtype presence well recognised as a marker for risk of death expression between myocytes and fibroblasts and demon- (Levy et al. 1994). Previously reported data suggest that strate mobilisation of intracellular calcium in response to regression of LVH associated with antihypertensive somatostatin in human cardiac fibroblasts. therapy is associated with improved outcome (Verdecchia et al. 1998, Mathew et al. 2001). The pathological changes in hypertensive LVH are similar to those found in acrome- Materials and Methods galy with disproportionate proliferation of cardiac fibro- blasts and accumulation of fibrillar collagen. This growth PCR analysis used to identify expression of human of the cardiac interstitium has significant functional effects somatostatin receptor subtypes on the left ventricle leading to abnormal relaxation and the The primer pairs used for PCR analysis are shown in Table clinical syndrome of heart failure even before the develop- 1. Optimal PCR conditions for amplification of all five ment of systolic dysfunction (Weber & Brilla 1991). receptor subtypes were established using a QUICK Screen Modulation of cardiac fibroblasts is therefore of particular universal human cDNA library (Clontech) as a template. interest in both acromegaly and hypertension. Several For sst1, sst3, sst4 and sst5 receptors, a GC-2 cDNA PCR factors have been shown to contribute to the development kit (Clontech) was used. Each 50 µl reaction consisted of: ff of LVH in hypertension but particular interest has focused 24 µl ultrapure H2O, 10 µl 5 bu er, 10 µl GC Melt, on IGF-I (for review see Delafontaine (1995)). 1µl50 dNTP mix (10 mM), 1 µl forward primer The peptide hormone somatostatin can inhibit both the (25 µM), 1 µl reverse primer (25 µM), 1 µl Advantage GC release and mitogenic effects of growth factors including Polymerase Mix, 2 µl template cDNA. Cycle parameters IGF-I. It exerts its effects through five G-protein-coupled used were: 94 C for 60 s (activation) followed by 35 cycles receptor subtypes (sst1–sst5). These receptors couple to a of 94 C for 30 s (melting) and 68 C for 180 s (combined variety of signal transduction pathways –including inhibi- annealing extension). This was followed by a final exten- tion of adenylate cyclase (Patel et al. 1994), mobilisation of sion period of 180 s at 68 C. For sst2 receptors, an intracellular calcium (Akbar et al. 1994) and activation of Advantage PCR kit (Clontech) was used. Each 50 µl protein tyrosine phosphatases (Buscail et al. 1995) – which reaction consisted of: 40 µl ultrapure H20, 5 µl 10 can inhibit cell proliferation. In rat heart, sst1, sst3 and sst4 cDNA PCR buffer, 1 µl 50 dNTP mix (10 mM), 1 µl are expressed but sst2 and sst5 are not, as evidenced by forward primer (25 µM), 1 µl reverse primer (25 µM), 1 µl mRNA expression (Bruno et al. 1993). In the human heart, Advantage Polymerase Mix, 1 µl template cDNA. Cycle mRNA encoding