US 2003O232421A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0232421 A1 Legrain et al. (43) Pub. Date: Dec. 18, 2003 (54) PROTEIN-PROTEIN INTERACTIONS IN Publication Classification ADIPOCYTE CELLS (3) (75) Inventors: Pierre Legrain, Paris (FR); Simon (51) Int. Cl." ......................... A61K 31/00; G01N 33/53; Whiteside, Cambridge (GB); Jen C07H 21/04; C12N 9/64; Mao, Palo Alto, CA (US); Irina Khrebtukova, San Francisco, CA (US); C12P 21/02; C12N 5/06 Shujun Luo, Berkeley, CA (US) (52) U.S. CI. ... 435/226; 435/69.1; 435/7.1; 435/320.1; 435/325; 536/23.2; Correspondence Address: 514/1 LERNER, DAVID, LITTENBERG, KRUMHOLZ & MENTLIK 600 SOUTHAVENUE WEST (57) ABSTRACT WESTFIELD, NJ 07090 (US) (73) Assignee: Hybrigenics, Paris (FR) The present invention relates to protein-protein interactions of adipocytes, e.g., complexes of Such polypeptides, poly (21) Appl. No.: 10/139,794 nucleotides encoding the polypeptides and complexes thereof, fragments of the polypeptides, antibodies to the (22) Filed: May 6, 2002 complexes, Selected Interacting Domains (SID) which are Related U.S. Application Data identified due to the protein-protein interactions, methods for Screening drugs for agents which modulate the interac (60) Provisional application No. 60/288,885, filed on May tion of proteins and pharmaceutical compositions that modu 4, 2001. late the protein-protein interactions. NO Wnt Wnt Signalling Patent Application Publication Dec. 18, 2003 Sheet 1 of 10 US 2003/0232421 A1 NO Wnt Wnt Signalling Figure 1 Patent Application Publication Dec. 18, 2003. Sheet 2 of 10 US 2003/0232421 A1 FIGURE 2 pB27. Alias: plexTetNS2 48 B. Agglication: 2HY (bit 79 it Backbone: B3 321 is Specificity. Sfi Oriented 455519 As Pre Selection tetracyclin 537 Egli Constructed by: CR 560 Xin 67 GR 615 S. S2S 113 628 A st 5900 636 Se! Ppu 10 5444 55 Asic Wis 5444 SSS Sf fr S444 667 Apal NSB 543B 6S7 Bsp120 Ava 5438 679 Ps pB27 33 Esix -- 152s Xg at 4550 - 6167 base pairs 1652 An Unicue Sites A 314 1894 PW Cal 4285 1949 Sapi Whe 48 2072 asplu11 Ace 48 Sgr A. 3898 2281 cW FM 35E2 243 Aw S 3658 Ps: 332 set olig46 A9,3 aaagicgaac Eigttgca agcgag tittaaacca attgtcgtaatcticgical gcagagcticaccatigaagggctggcggiggggtiaticgcaacggcgaciggctgoli 2678 EcoRI SI Sac II Spe GAA TTC GGG GCC GGA CGG GCC GCG GCC GCA CTA GTG GGG ATC Not I STOP sfi I Apal Pst CTT AAT GGG CCA CTG GGG CCC CTC GAC CTG CAG Pac I oliga 7 ccaagctaatticeggcgaatticitatgatatgattittattataaataagttataaaaaaaataa oli161 Oligo 946 5 TGTTGCCAGAAAATAGCGAG3' Oligo 947 s AATTCGCCCGGAATTAGC3 Oligo 161 3 CATAAGAAATTCGCCCGG 3 ' Oligo 2678s: AGCTTCACCATTGAAGGGCT3 . Patent Application Publication Dec. 18, 2003 Sheet 3 of 10 US 2003/0232421 A1 FIGURE 3 pB20 Alias: plex1ONS2 Agglication: 2HY (bit) Backbone: plexi (E9) S1 stE Specificity. Sfi-oriented 47 ric Selection: amplicillin 447 Heal Constructed by: LD 486 c. S17 AJ 759 is 957 Ane 975 Bigf 998 X Apu 10 5451 145 ER Ns 5451 53 S 3frt sas 164 stS W387' 5445 1064 A113 Awa 5445 1064 Sae OSS Ni 1067 Asgf 1074 Spei B2H 188 Act 7 S 1105 Apg| 115 Bs120 2 1117. As pB20 1329 ae 1329 NoMM Agil 431 -- 5746 base pairs Unicue Sites 161 BSF 75 Bex A 377 1964 Xia 1970 Apa Sitar 3, 2332 Awi A 3398 2387 Sap Aw 2921 250 split EcoRI Sf Not Spe GAA TTC GGG GCC GGA CGG GCC GCG GCC GCA CTA GTG Sac II BamHI STOP GGG ATC CTT AAT GGG CCA CTG GGG CCC CTC GAC Pat I Sfi CTG CAG Pst I Patent Application Publication Dec. 18, 2003 Sheet 4 of 10 US 2003/0232421 A1 FIGURE 4 pP6 358 asg "...A Alias: pgAD3S2XNS! 17 Application: 2HY (prey) Backbone: pGAD3S2X B4A113 Sgecificity. Sfinon-oriented Bs 2 Selection attpicillin AlgoMMBau 1 of 7D 7091 85937 Speltamp H Constructed by SW Age 7 B82S 8GOApal As 945 89.3a as 45 ago ap 120 Ps 30 8. So Sf 308 893Xho Sahi B803 G11 Xhai Fou 10 esoe is 58 134s Bir SO8 SB 54 3. A 154 pP6 779 base pairs Unique Stes A sas 249A 2ssassir Fl 223 arg 497B 273 as EI P. 4327 262AM 2883 Pauh A 4A55 31s2 Sea AN 377 333A ABS1 3443 Saal cgt. gga atC eace GAT TTTAATACCACTACAATGGATGATGTATATA ACTATCTATT 188 CCCAAAAAAAGAGATCCTAGAACTA. JC9) SI Sac II Spe Bam H.I GCC ATG GCC GCA. GGG (GCC GCG GCC GCA CTA GTG GGG ATC C Nico Not I STOP SI XhoI ba TT AAT GGG CCA CTG GGG CCC CTC GAG CTA GTG TCT AGA STOP STOP STOP GGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCG TCGTTTTA. CAACGTCGTGACTGGGAAAACCCTGATCTATGAAT GCAA ABS2 53 ABS1 5' CGTTTGGAATCACTACAGG 3' JC90 5' CGATGATGAAGATACCCCACCAAA 3' 62 5' GGGGTTTTTCAGTATCTACG 3 ABS2 5’ CACGATGCACAGTTGAAGTG 3' 53 5 GAAATTGAGATGGTGCACGATGCAC 3' Patent Application Publication Dec. 18, 2003. Sheet 5 of 10 US 2003/0232421 A1 VVLOVVLOOVIÐ?OOOOOLVOOVOVLOLOV?OI,popyooL09 VVJ.OVVLOOVL9000OOOLVOOVOVIOLOVOOI.999VOOIOD LIVOLI.V90LVOOOÐOÐOVLOOLOVOJ.O?oyOOOIOOvypo GERITISDI SOWI97.I, IŠ? bwyd omd Patent Application Publication Dec. 18, 2003 Sheet 7 of 10 US 2003/0232421 A1 FIGURE 7 plac UV5 cyaA. Mcs Cat Orip15A N x: 224 ------ N - --- 2 Pst BamH Kpn s gctgcagggtogactictagaggatCCCCggg tacctaagtaactaagaattic A A G S T L E D P R V P K stop plac UV5 acz cyaA" bla OriC K5n) MCS tggg- taccgggCCCCCCCtcgaggtogacggt atcgataagcttgatatogaatticct W V P G P P S R S T W S S L S N S Patent Application Publication Dec. 18, 2003 Sheet 8 of 10 US 2003/0232421 A1 Protein Selected fragments (Preys) interacting domain Fig. 8 Selectide Interaction Domain (SID(8) Patent Application Publication Dec. 18, 2003. Sheet 9 of 10 US 2003/0232421 A1 FIGURE 9 Protein interaction Map (PIMG)) Patent Application Publication Dec. 18, 2003 Sheet 10 of 10 US 2003/0232421 A1 FIGURE 10 pB28 Alias: L exTetNS1 Agglication 2HYCbai) Bagkbone: B3 Specificity. Sfinon-oriented Selection: tetra cyclin Constructed by: CR al 43 c. g 32.12 458 SE. 519 Age 537 agil SGXcar 607 EcoR 15s E2S 113 2 Sci 28th As so B3tsoc Saei Fu 105444 5 S. is 5444 39 SA44 7 Anal 38 SA38 Be7 as 120 Aya I 54.38 & 679 Pst pB28 2S X as -- as a 6167 base pairs Urique Sites E. Egg" fe 4080 272 assau11 Ace 408 Sgr A. 388 223 acf W Aco NE 332 243 ArN Sa 3858 *::: 3.323s Act 34 333 EcoR Sf Sac II Spe GAA TTC GGG GCC GCA. GGG GCC GCG GCC GCA CTA GTG GGG ATC Not I STOP sfi I Apa I Pst CTT AAT GGG CCA CTG GGG CCC CTC GAC CTG CAG Pac US 2003/0232421 A1 Dec. 18, 2003 PROTEIN-PROTEIN INTERACTIONS IN trol to evaluate the activation or inhibition properties of the ADIPOCYTE CELLS (3) third partner due to its “on” and “off” Switch for the formation of the transcriptional activator. The three-hybrid PRIORITY method is described, for example in Tirode et al., The 0001. This application claims priority on the basis of U.S. Journal of Biological Chemistry, 272, No. 37 pp. 22995 Provisional Application No. 60/288,885 filed May 4, 2001, 22999 (1997) incorporated herein by reference. incorporated herein by reference. 0008 Besides the two and two-hybrid plus one systems, yet another variant is that described in Vidal et al., Proc. Natl. BACKGROUND Sci. 93 pgs. 10315-10320 called the reverse two- and 0002 Most biological processes involve specific protein one-hybrid Systems where a collection of molecules can be protein interactions. Protein-protein interactions enable two Screened that inhibit a specific protein-protein or protein or more proteins to associate. A large number of non DNA interactions, respectively. covalent bonds form between the proteins when two protein 0009. A summary of the available methodologies for Surfaces are precisely matched. These bonds account for the detecting protein-protein interactions is described in Vidal Specificity of recognition. Thus, protein-protein interactions and Legrain (Nucleic Acids Research Vol. 27, No. 4 pgs. are involved, for example, in the assembly of enzyme 919-929 (1999)) and Legrain and Selig (FEBS Letters 480 Subunits, in antibody-antigen recognition, in the formation pgs. 32-36 (2000)) which references are incorporated herein of biochemical complexes, in the correct folding of proteins, by reference. in the metabolism of proteins, in the transport of proteins, in the localization of proteins, in protein turnover, in first 0010. However, the above conventionally used translation modifications, in the core Structures of viruses approaches and especially the commonly used two-hybrid and in Signal transduction. methods have their drawbackS. For example, it is known in the art that, more often than not, false positives and false 0.003 General methodologies to identify interacting pro negatives exist in the Screening method. In fact, a doctrine teins or to Study these interactions have been developed. has been developed in this field for interpreting the results Among these methods are the two-hybrid System originally and in common practice an additional technique Such as developed by Fields and co-workers and described, for co-immunoprecipitation or gradient Sedimentation of the example, in U.S. Pat. Nos. 5,283,173, 5,468,614 and 5,667, putative interactors from the appropriate cell or tissue type 973, which are hereby incorporated by reference. are generally performed. The methods used for interpreting 0004. The earliest and simplest two-hybrid system, which the results are described by Brent and Finley (Jr. in Ann. Rev. acted as basis for development of other versions, is an in Genet., 31 pgs. 663-704 (1997)). Thus, the data interpreta Vivo assay between two specifically constructed proteins. tion is very questionable using the conventional Systems.