Journal of Cell Science 108, 1617-1627 (1995) 1617 Printed in Great Britain © The Company of Biologists Limited 1995 Mapping the distribution of Golgi enzymes involved in the construction of complex oligosaccharides Catherine Rabouille, Norman Hui, Felicia Hunte, Regina Kieckbusch, Eric G. Berger*, Graham Warren and Tommy Nilsson† Cell Biology Laboratory, Imperial Cancer Research Fund, 44 Lincoln’s Inn Fields, London, WC2A 3PX, UK *Present address: Physiologisches Institut, Universität Zürich, Switzerland †Author for correspondence SUMMARY The distribution of β1,2 N-acetylglucosaminyltransferase I tion but they occupied the trans cisterna and the trans- (NAGT I), α1,3-1,6 mannosidase II (Mann II), β1,4 galac- Golgi network (TGN). These results generalise our earlier tosyltransferase (GalT), α2,6 sialyltransferase (SialylT) observations on the overlapping distribution of Golgi was determined by immuno-labelling of cryo-sections from enzymes and show that each of the trans compartments of HeLa cell lines. Antibody labelling in the HeLa cell line was the Golgi apparatus in HeLa cells contains unique mixtures made possible by stable expression of epitope-tagged forms of those Golgi enzymes involved in the construction of of these proteins or forms from species to which specific complex, N-linked oligosaccharides. antibodies were available. NAGT I and Mann II had the same distribution occupying the medial and trans cisternae Key words: Golgi apparatus, trans-Golgi network, of the stack. GalT and SialylT also had the same distribu- glycosyltransferase, mannosidase, TGN38 INTRODUCTION two adjacent cisternae was taken as evidence of cisternal dupli- cation. This interpretation was supported by the observation The construction of complex, bi-antennary, N-linked oligosac- that the number of cisternae in the Golgi stack can vary widely charides involves the sequential action of enzymes located in from tissue to tissue and from organism to organism (see different parts of the Golgi apparatus (for reviews, see Kornfeld Fawcett, 1981). To investigate the possibility of cisternal and Kornfeld, 1985; Roth, 1991). α1,2 mannosidase I continues duplication, we examined, using immunogold electron the trimming of mannose residues that started in the endoplas- microscopy, the distribution of NAGT I and GalT in HeLa mic reticulum (ER) leaving a penta-mannose core to which the cells. Each enzyme was found in two, adjacent cisternae but, first N-acetylglucosamine is added by β1,2 N-acetylglu- contrary to expectation, both were present in the trans cisterna cosaminyltransferase I (NAGT I). α1,3-1,6 mannosidase II (Nilsson et al., 1993). In other words, the two enzymes had an (Mann II) removes two more mannose residues permitting overlapping distribution such that each cisterna contained a addition of the final N-acetylglucosamine by β1,2 N-acetylglu- unique mixture of enzymes not a unique set. In order to gen- cosaminyltransferase II. Each branch can then be elongated by eralise these observations and obtain further evidence against the addition of galactose by β1,4 galactosyltransferase (GalT) cisternal duplication and in favour of each cisterna having a and sialic acid by α2,6 sialyltransferase (SialylT). Fucose may unique composition, we have extended our observations to also be added prior to or following the addition of sialic acid. other Golgi enzymes. To do this we have generated a series of GalT was the first of these enzymes to be localised, first to stable HeLa cell lines expressing either epitope-tagged the trans cisterna (Roth and Berger, 1982) and later to the enzymes or ones to which antibodies were available. trans-Golgi network (TGN) (Lucocq et al., 1989; Nilsson et al., 1993). SialylT was found to localise to the trans Golgi cisterna and the TGN (Roth et al., 1985) and to have the same MATERIALS AND METHODS distribution in most though not all cells (Roth et al., 1986). Stable cell lines NAGT I was found in medial cisternae (Dunphy et al., 1985) as, more recently, was Mann II (Velasco et al., 1993). The HeLa cell lines expressing either human NAGT I (Kumar et al., 1990) tagged with a myc-epitope or murine Mann II (Moremen and Robbins, location of these enzymes strongly supported the idea that 1991) have been described elsewhere (Nilsson et al., 1993, 1994). proteins undergoing transport moved through the stack in a Human SialylT (Grundmann et al., 1990) was tagged with a VSV- cis to trans direction, sampling each of the compartments in G epitope (underlined) (Kreis, 1986; Soldati and Perriard, 1991) using turn. PCR (Saiki et al., 1988) to introduce the epitope immediately prior to The fact that most of these enzymes were usually found in the stop codon. Primers used were: 1618 C. Rabouille and others Table 1. Stable HeLa cell lines used in this study Antibody used to detect the Expression level relative Cell line Origin of expressed protein Epitope tag stably-expressed protein(s) to endogenous protein* NAGT I-HeLa Human myc 9E.10 monoclonal 4-fold Mann II-HeLa Mouse None Polyclonal anti-murine Mann II 6-fold SialylT-HeLa Human VSV-G P5D4 monoclonal 50 to 100-fold TGN38/SialylT-HeLa SialylT Human VSV-G P5D4 monoclonal 10-fold TGN38 Rat None Polyclonal anti-rat TGN38 2.5-fold *Measured by the increase in enzyme activity (NAGT I and SialylT) or by comparing the linear density of gold labelling over the Golgi with that in NRK cells (Mann II and TGN38). Parental HeLa cells were transfected with pSRα containing the appropriate cDNA and stable lines selected as described in Materials and Methods. 5′GTCGACGGATCCACCATGATTCACACCAACCTGAAG3′; Laboratories, Cardiff, UK) were used to detect the primary mono- and clonal antibodies whereas goat anti-rabbit antibodies coupled to gold 5′GTCGACGGATCCTTACTTTCCCAGCCTGTTCATCTCTA- (Biocell Research Laboratories, Cardiff, UK) or Protein A gold (from TATCGGTGTAAGGGCAGTGAATGGTCCGGAAGCC3′. Dept of Cell Biology, Utrecht School of Medicine, Utrecht, the The PCR product was sequenced and subcloned into the BamHI Netherlands) were used to detect primary polyclonal antibodies. site of pSRα (DNAX, Palo Alto, CA). Two protocols were used for double-labelling experiments. When A full length cDNA encoding rat TGN38 (Luzio et al., 1990) was one of the primary antibodies was a monoclonal and the other a poly- digested with HindIII and complementary oligonucleotides encoding clonal, they were mixed together for the initial incubation with the a BamHI site were introduced immediately following the stop codon. section. Each of the secondary antibodies was then added sequentially The complementary oligonucleotides were: (Nilsson et al., 1993). When both antibodies were polyclonal, incu- 5′AGCTTTGAG3′ and 5′GATCCTCAA3′. bation with the first primary antibody was followed by goat anti-rabbit The coding region of TGN38 was then excised and subcloned into or Protein A coupled to one size of gold. Sections were then fixed for the BamHI site of pCMUIV (Nilsson et al., 1989). 15 minutes in 4% paraformaldehyde and the second primary antibody HeLa cells were transfected with tagged SialylT in pSRα either added followed by goat anti-rabbit or Protein A coupled to a different alone or together with TGN38 in pCMUIV. Transfection and isolation size of gold (Slot et al., 1991). of stable lines was carried out essentially as described previously Grids were stained with 2% neutral uranyl acetate and embedded (Nilsson et al., 1994). Table 1 summarises relevant properties of the in 2% methyl cellulose containing 0.4% uranyl acetate as described HeLa cell lines used. Membrane fractionation and western blotting SialylT-HeLa and TGN38/SialylT-HeLa cells were grown in NAGT I N C Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) supple- 6 23 418 mented with 10% foetal calf serum, penicillin (100 µg/ml), strepto- mycin (100 µg/ml) and geneticin (500 µg/ml) (Gibco). Approximately 109 cells were used to isolate Golgi membranes (Balch et al., 1984) which were purified at least 10-fold over homogenate assayed by MannII NC GalT activity (Bretz and Stäubli, 1977). Protein concentration was determined using the BCA protein assay kit (Pierce Chemical Co, 5 21 1124 Rockford, IL). SDS-PAGE was carried out essentially as described by Blobel and Dobberstein (1975) and western blotting as described previously (Nilsson et al., 1993). SialylT was assayed as described by Dunphy et al. (1981) using asialo-transferrin as the substrate. GalT NC Immunogold electron microscopy 24 20 354 Cells were fixed either in 2% paraformaldehyde and 0.2% glu- taraldehyde in 0.1 M phosphate buffer, pH 7.4, or in 0.5% glu- taraldehyde in the same buffer containing 0.2 M sucrose and processed as described previously (Rabouille et al., 1993). Briefly, SialylT N C cells were embedded in 10% gelatine and small blocks were infused 9 17 380 with 2.3 M sucrose and frozen in liquid nitrogen. Ultra-thin cryosec- tions were cut on an Ultracut E microtome with FC4E cryo-attach- ment and transferred onto collodion-carbon coated, copper or nickel, 100-mesh grids. All antibodies and gold conjugates were diluted in TGN38 C N 0.5% fish skin gelatine in PBS. 34 19 287 The following primary antibodies were used: the 9E.10 mouse monoclonal antibody which recognises the c-myc epitope (Evan et al., Fig. 1. Topology of the hybrid proteins stably expressed in HeLa 1985) at the C-terminus of NAGT I; a rabbit polyclonal antibody cells. Parental HeLa cells were selected for stable expression of recognising rat Mann II (Moremen et al., 1991); a rabbit polyclonal NAGT I, Mann II, SialylT or TGN 38 (together with SialylT). The antibody (N11) recognising human GalT (Watzele et al., 1991); the topology of the endogenous GalT is presented for comparison. The P5D4 mouse monoclonal antibody which recognises the VSV-G tag numbers (from left to right) refer to the length (not to scale) of the (Kreis, 1986; Soldati and Perriard, 1991) at the C-terminus of SialylT; cytoplasmic tail, the membrane-spanning domain, the lumenal and a rabbit polyclonal antibody recognising rat TGN38 (Luzio et al., domain and the epitope tag (where present).