ST14 (NM 021978) Human 3' UTR Clone – SC207486 | Origene

ST14 (NM 021978) Human 3' UTR Clone – SC207486 | Origene

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC207486 ST14 (NM_021978) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: ST14 (NM_021978) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: ST14 Synonyms: ARCI11; CAP3; HAI; MT-SP1; MTSP1; PRSS14; SNC19; TADG15; TMPRSS14 ACCN: NM_021978 Insert Size: 569 bp Insert Sequence: >SC207486 3’UTR clone of NM_021978 The sequence shown below is from the reference sequence of NM_021978. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC GACTGGATCAAAGAGAACACTGGGGTATAGGGGCCGGGGCCACCCAAATGTGTACACCTGCGGGGCCAC CCATCGTCCACCCCAGTGTGCACGCCTGCAGGCTGGAGACTGGACCGCTGACTGCACCAGCGCCCCCAG AACATACACTGTGAACTCAATCTCCAGGGCTCCAAATCTGCCTAGAAAACCTCTCGCTTCCTCAGCCTC CAAAGTGGAGCTGGGAGGTAGAAGGGGAGGACACTGGTGGTTCTACTGACCCAACTGGGGGCAAAGGTT TGAAGACACAGCCTCCCCCGCCAGCCCCAAGCTGGGCCGAGGCGCGTTTGTGCATATCTGCCTCCCCTG TCTCTAAGGAGCAGCGGGAACGGAGCTTCGGGGCCTCCTCAGTGAAGGTGGTGGGGCTGCCGGATCTGG GCTGTGGGGCCCTTGGGCCACGCTCTTGAGGAAGCCCAGGCTCGGAGGACCCTGGAAAACAGACGGGTC TGAGACTGAAATTGTTTTACCAGCTCCCAGGGTGGACTTCAGTGTGTGTATTTGTGTAAATGAGTAAAA CATTTTATTTCTTTTTA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_021978.4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 ST14 (NM_021978) Human 3' UTR Clone – SC207486 Summary: The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008] Locus ID: 6768 MW: 20.9 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us