International Journal of Systematic and Evolutionary Microbiology (2002), 52, 2003–2010 DOI: 10.1099/ijs.0.02191-0 Phylogenetic analysis of the genus Pediococcus, including Pediococcus claussenii sp. nov., a novel lactic acid bacterium isolated from beer 1 Department of C. Melissa Dobson,1 Harry Deneer,1 Sun Lee,2 Sean Hemmingsen,3 Microbiology and 1 1 Immunology, University of Sarah Glaze and Barry Ziola Saskatchewan, 107 Wiggins Road, Saskatoon, Saskatchewan, Author for correspondence: Barry Ziola. Tel: j1 306 966 4330. Fax: j1 306 966 4311. Canada S7N 5E5 e-mail: ziola!sask.usask.ca 2 Brewing Research and Development, Coors Brewing Company, BC 600, Pediococci are found in foods and on plants and as beer-spoilage agents. The Golden, CO 80401-1295, goal of the present study was to use the DNA sequences of the first three USA variable regions of the 16S rRNA gene, the 16S–23S rRNA internally transcribed 3 Plant Biotechnology spacer region sequence and approximately a third of the 60 kDa heat-shock Institute, National protein gene to elucidate phylogenetic groupings within the genus Research Council, 110 Gymnasium Place, Pediococcus. Phylogenetic trees were created with sequence data from 31 Saskatoon, Saskatchewan, Pediococcus and three Lactobacillus isolates. Complete 16S rRNA gene Canada S7N 0W9 sequences from selected Pediococcus isolates were also examined. The results were interpreted in relation to the currently accepted Pediococcus species. We found that, where previously done, speciation of many Pediococcus isolates is inaccurate. Also, one grouping of seven isolates did not include any currently recognized Pediococcus species type isolate. Our phylogenetic analyses support the conclusion that these seven isolates, all of brewing spoilage origin, belong to a novel species, for which the name Pediococcus claussenii sp. nov. is proposed (type strain P06T l ATCC BAA-344T l DSM 14800T). Phylogenetic analysis has therefore helped to resolve problems surrounding species identification of Pediococcus isolates. Keywords: beer-spoilage bacteria, lactic acid bacteria, Pediococcus claussenii, Pediococcus phylogenetics INTRODUCTION has been based on habitat, DNA–DNA hybridization results and tolerance of temperature, pH and NaCl Pediococci are lactic acid bacteria found on plants and (Garvie, 1974, 1986). However, speciation of Pedio- in many fermented foods (Garvie, 1986). Pediococci coccus isolates has been difficult. have been added as nutritional enhancers of animal While phenotypic patterns are useful in classifying feeds and, more recently, have been used in polymer variable organisms, bacteria often exhibit similar research for production of biodegradable packaging characteristics, making speciation difficult. As protein materials. In addition to beneficial aspects, when and nucleic acid sequences allow direct assessment of present in beer, pediococci produce diacetyl, causing a evolutionary relationships, phylogenetics is increas- quality problem for brewers. Pediococcus speciation ingly being used to redefine bacterial taxonomy. The most extensive studies regarding the phylogenetics of ................................................................................................................................................. bacteria are based on the 16S rRNA gene. Using 16S Published online ahead of print on 27 May 2002 as DOI 10.1099/ rRNA gene sequences, the genus Pediococcus was ijs.0.02191-0. reported to fall within the Lactobacillus casei branch of Abbreviations: HSP60, 60 KDa heat-shock protein; ITS, internally tran- the lactic acid bacteria, with Pediococcus dextrinicus as scribed spacer; MRS, Man–Rogosa–Sharpe; OTU, operational taxonomic unit; RDP, Ribosomal Database Project. a distantly related species (Collins et al., 1990, 1991; The GenBank accession numbers for the 16S rRNA gene, ITS and HSP60 Collins & Wallbanks, 1992). Within the Pediococcus sequences of isolate P06T are AF404716, AF405360 and AF405395. Accession taxon, Pediococcus damnosus and Pediococcus parvulus numbers of other sequences obtained in this study are listed in Table 1. formed one cluster, while Pediococcus acidilactici and 02191 # 2002 IUMS Printed in Great Britain 2003 C. M. Dobson and others Pediococcus pentosaceus formed a second cluster. of each run was 20% methanol in buffer. The column was Currently, seven Pediococcus species are recognized, run at 25 mC for one analysis, while two analyses were done including P. acidilactici, P. damnosus, P. dextrinicus, at 30 mC. As the HPLC conditions do not resolve uracil from Pediococcus inopinatus, P. parvulus, P. pentosaceus and dC, GjC content (mol%) was calculated as 100i[dG]\ Pediococcus urinaeequi. It should be noted that Collins ([dG]j[T]). et al. (1990) have suggested that P. urinaeequi should DNA extraction. Bacterial cells from 2 ml overnight culture were collected by centrifugation and resuspended in 200 µl be reclassified in the genus Aerococcus; however, no −" official opinion on this suggestion has been rendered. of a solution of 5 mg lysozyme ml . After 30 min at room temperature, DNA was extracted using the universal pro- Using 16S rRNA gene sequences to infer organismal cedure of Golbang et al. (1996). The extracted DNA was phylogeny has been criticized, as it assumes that one allowed to air dry for 5 min before being dissolved in 50 µl molecule reflects organismal evolutionary history. autoclaved, 0n2 µm-filtered reverse-osmosis deionized water. Variability in the 16S–23S rRNA internally tran- Samples of each batch of MRS broth were subjected to scribed spacer (ITS) region has also been used for DNA extraction and PCR amplification to ensure that phylogenetic analyses (Frothingham & Wilson, 1994; contamination by unknown microbial contaminants had not occurred. Nour, 1998). To study the ITS region, conserved flanking regions of the 16S and 23S rRNA genes are PCR amplification. Each sample contained 1iTaq buffer used as PCR primer-binding sites. Further corrob- (Invitrogen), 1n5 mM MgCl#,0n2 mM of each dNTP, 0n2 µM oration of phylogeny can be based on highly conserved of each primer, 1 µl template bacterial DNA and 2n5U Platinum Taq polymerase (Invitrogen) in 100 µl reverse- proteins that are essential for survival (i.e. have osmosis deionized water. Primers 8F (5h-AGAGTTTGAT- properties of a molecular chronometer; Woese, 1987). CCTGGCTCAG-3h) and 534R (5h-ATTACCGCGGCTG- One such protein is the 60 kDa heat-shock protein CTGG-3h) were used to amplify the first 526 bp of the 16S (HSP60), which performs an essential protein-folding rRNA gene (Relman, 1991; Muyzer et al., 1993). To obtain function in cells (Gupta et al., 1995; Braig, 1998). the whole sequence of the 16S rRNA gene for isolates P03 and P06, primers 515F (5h-TGCCAGCAGCCGCGGTAA- In our examination of the phylogeny of the genus 3h) and 1542R (5h-GGCTACCTTGTTACGACTT-3h) were Pediococcus, we used sequence information from three used (Weisburg et al., 1989). Primers S2 (5h-TTGTACAC- genomic regions, including the 16S rRNA gene, ACCGCCCGTCA-3h) and S7 (5h-GGTACTTAGATGTT- 16S–23S rRNA ITS region and HSP60 gene. We also TCAGTTC-3h) were used to amplify the ITS region (Gu$ rtler examined a larger number of Pediococcus isolates than & Stanisich, 1996). The primers used to amplify a portion of previous studies of this genus. Each of the three the HSP60 gene were H729 [5h-cgccagggttttcccagtcacgacG- phylogenetic trees created have similar topologies. The AIIIIGCIGGIGA(T\C)GGIACIACIAC-3h] and H730 [5h- results are used to redefine the current species desig- agcggataacaatttcacacagga(T\C)(T\G)I(T\C)(T\G)- nations of Pediococcus isolates and to define a novel ITCICC(A\G)AAICCIGGIGC(T\C)TT-3h] (Goh et al., Pediococcus species. 2000). The conserved residues in the HSP60 gene are flanked by M13 sequences M13k40 and M13k48 (lower-case). With primers 8F and 534R, the PCR conditions were one METHODS cycle of 5 min at 95 mC, 35 cycles of 1n25 min at 94 mC, 1 min Bacteria. Lactobacillus and Pediococcus isolates examined at 60 mC and 1 min at 72 mC and one cycle of 10 min at 72 mC. are listed in Table 1. Each isolate was first streaked on With primers 515F and 1542R, the annealing temperature Man–Rogosa–Sharpe (MRS) agar and grown at 27 mC. was reduced to 42 mC. When the ITS region was amplified, Colony morphology, exopolysaccharide production and the annealing temperature was 55 mC and last cycle lasted for Gram-staining properties were determined and five colonies 8 min (Gu$ rtler & Stanisich, 1996). For amplification of the with uniform properties were combined and grown in MRS HSP60 gene, the first cycle was for 3 min, 40 cycles were used broth. Substrate fermentation was assessed using the API 50 and the annealing temperature was 37 mC (Goh et al., 1996, CH kit (bioMe! rieux). Incubation was at 27 mC, with results 2000). recorded daily for 7 days to ensure that a minor contaminant PCR product purification. PCR amplification of the 16S was not growing as well. Escherichia coli ATCC 11030 and rRNA gene and HSP60 gene segments gave single bands of Staphylococcus aureus ATCC 25923 were propagated at 526 and 652 bp, respectively. The products were purified 37 mC in Oxoid nutrient broth 2. All bacteria were stored at using a QIAquick Spin PCR purification system (Qiagen). k70 mC in double-strength skim milk. The ITS region PCR resulted in one bright band at 530 bp and two weaker bands, at 650 and 750 bp. The latter two GjC content determination. Cells from 10 ml medium were bands are of the appropriate sizes for ITS regions containing lysed at 60 mC for 30 min in 400 µl 10 mM Tris\HCl, pH 8n0, one and two tRNAs, respectively (Gu$ rtler & Stanisich, 10 mM EDTA and 0n5% SDS, to which 6 µl proteinase K −" 1996; Nour, 1998). As an ITS region containing no tRNAs (20 mg ml in 10 mM Tris\HCl, pH 7n5, containing 20 mM would yield a product of approximately 530 bp (Nour, CaCl# and 50% glycerol) was added. After boiling for 5 min, DNA was isolated using an Epicentre Masterpure DNA 1998), this band was selected. After the band was excised extraction kit. Extracted DNA was digested according to the from the gel, the DNA was purified as described by Zhen & standard method of Mesbah et al.