INTERNATIONAL JOURNAL OF ONCOLOGY 43: 1871-1884, 2013 Investigating a pathogenic role for TXNDC5 in tumors XIAOTIAN CHANG1, BING XU1, LIN WANG2, YAO WANG1, YUEJIAN WANG1 and SUHUA YAN1 1Medical Research Center of Shandong Provincial Qianfoshan Hospital, Shandong University, Jinan, Shandong 250014; 2Research Center for Medicinal Biotechnology, Shandong Academy of Medical Sciences, Jinan, Shandong 250062, P.R. China Received June 29, 2013; Accepted August 2, 2013 DOI: 10.3892/ijo.2013.2123 Abstract. The expression of TXNDC5, which is induced by rs7771314, rs2815128, rs13210097 and rs9392182 between hypoxia, stimulates cell proliferation and angiogenesis. The cervical carcinoma, esophageal carcinoma and liver cancer increased cell proliferation, angiogenesis and hypoxia are main patients and controls. These results suggest that TXNDC5 has features of tumor tissues. The present study aimed to charac- increased expression in many tumors that is involved in the terize the expression of TXNDC5 in various tumor types and proliferation and migration of tumor cells, acting as a tumor- to investigate the role of TXNDC5 in the growth, prolifera- enhancing gene. The study also suggests that TXNDC5 gene tion and migration of tumor cells. The study also determined is susceptible to cervical carcinoma, esophageal carcinoma susceptibility of TXNDC5 gene on tumor risk. The expression and liver cancer risk. of TXNDC5 in tumor tissues was determined by immunohis- tochemistry using a tissue array that contained various types Introduction of tumor tissues. The expression levels of TXNDC5 in tumor tissues and healthy tissues were quantitatively analyzed using Thioredoxin domain containing 5 (TXNDC5) protein, also western blotting. Furthermore, HeLa cells and U2OS cells named ERp46, has a protein disulfide isomerase (PDI) domain were treated with anti-TXNDC5 siRNA to knockdown the that exhibits a high sequence similarity to thioredoxin, a cata- expression levels of TXNDC5 to study its role in cell prolifera- lyst of the rate limiting reaction of disulfide bond formation, tion and migration. The cell proliferation and migration of the isomerization and reduction (1,2). Yeast complementation tests transfected tumor cells were determined by MTT and Transwell showed that TXNDC5 can conduct PDI functions in vivo (3). migration assays, respectively. Ninety-six tag SNPs across Indirect immunofluorescence microscopy and subcellular the TXNDC5 locus were genotyped using custom-designed fractionation studies have shown that TXNDC5 is present both Illumina 384-SNP VeraCode microarrays. Our immunohisto- in the endoplasmic reticulum and in the plasma membrane (4). chemical staining revealed significant expression of TXNDC5 TXNDC5 is highly expressed in endothelial cells during in breast invasive ductal carcinomas, cervical squamous cell hypoxic conditions, and it plays important roles in anti-oxida- carcinomas, esophageal squamous cell carcinomas, gastric tive injury, anti-anoxia-induced apoptosis and the promotion carcinomas, hepatocellular carcinomas, ovarian papillary of cell proliferation (1,2). serous carcinomas, prostate cancers and undifferentiated cell Recent studies reported that TXNDC5 is over expressed in carcinomas of the lung. Western blot analysis also detected some tumors including the cervix, uterus, stomach and lung significantly higher TXNDC5 expression in tumor tissues of cancers (5). Wang et al also found that TXNDC5 was signifi- breast cancers, gastric adenocarcinomas and rectal cancers cantly upregulated in colorectal cancer tissues compared with compared to the adjacent healthy tissues. Decreased growth normal mucosa (6). Vincent et al demonstrated that 62% and invasive potential were observed in cultured HeLa cells of non-small cell lung carcinomas exhibit an increase in and U2OS cells when TXNDC5 gene expression was knocked TXNDC5 expression compared with normal lung tissue (7). down. The case-control analysis showed a significant differ- TXNDC5 has been reported to be involved in cancer progres- ence in allele frequency and genotype frequency for rs9505298, sion. Zhang et al inserted TXNDC5 cDNA into the gastric cell line HFE145. They demonstrated that TXNDC5 promotes growth, proliferation and invasion of gastric cells (8). Thus, TXNDC5 can be thought of as a tumor-enhancing gene. However, there is no comprehensive investigation reported on Correspondence to: Professor Xiaotian Chang, Medical Research TXNDC5 expression in various tumor types, and not much Center of Shandong Provincial Qianfoshan Hospital, Shandong University, Jingshi Road 16766, Jinan, Shandong 250014, P.R. China is known about the functional roles of the TXNDC5 in the E-mail: [email protected] tumorigenic process. In the present study, we investigated the expression of Key words: TXNDC5, tumor, cell proliferation, cell migration, TXNDC5 in various tumors. We also investigated the role susceptibility of TXNDC5 in cell proliferation and migration of cultured tumor cell lines using small interfering RNAs. In addition, we determined whether common polymorphisms in TXNDC5 1872 CHANG et al: TXNDC5 AND TUMORS are associated with various tumors using microarray. To our To determine the antibody specificity and optimize the knowledge, this is the first study to examine this potential antibody dilution, the tissue samples were incubated with goat association of the genes with tumors. pre-immune serum (Maixin-Bio) or treated with the modifica- tion buffer without addition of antibody. Materials and methods Inhibiting TXNDC5 expression in cultured tumor cell lines with Western blot analysis. Breast cancer (n=4), gastric adeno- siRNAs. HeLa cells (originally from human cervical cancer) and carcinoma (n=4) and rectal cancer (n=4) tissue samples were U2OS cells (originally from human osteosarcoma) were cultured collected during excision surgery in Shandong Provincial in McCoy's 5A medium (Gibco-BRL, Carlsbad, CA, USA) Qianfoshan Hospital (Jinan, China). Parallel healthy tissues supplemented with 100 U/ml penicillin, 100 mg/ml streptomycin 5 cm from the tumors were also collected during the excision (Gibco-BRL) and 15% (v/v) fetal bovine serum (Gibco-BRL). surgery. The tumor diagnosis was verified by histological siRNA oligonucleotides targeting TXNDC5 (target mRNA methods, and pathological categorization was performed sequence: 5'-CACATACAGGCTTAAGCTCTA-3') were according to the World Health Organization (WHO) clas- designed and synthesized by Qiagen (Hilden, Germany). sification system. All patients signed informed consents, and Cultured tumor cells were transfected with 100 nM of the this study was approved by the ethics committee of Shandong siRNA using the HiPerFect transfection reagent (Qiagen) Provincial Qianfoshan Hospital. according to the manufacturer's protocol. The cells were Two hundred micrograms of the tumor tissues from gastric harvested for analysis 48 h following the transfection. adenocarcinoma, rectal cancer, breast cancer and their parallel Mm/Hs-MAPK1 siRNA (AATGCTGACTCCAAAGCTCTG) healthy tissues were homogenized in Cell Lysis Solution and AllStars Negative Control siRNA, which were provided (Sigma) and centrifuged at 16,000 x g for 5 min at 4˚C. The total with the kit, were used as positive and negative controls, protein was separated by sodium dodecyl sulfate-polyacryl- respectively, in parallel transfections. Mm/Hs_MAPK1 Control amide gel electrophoresis (SDS-PAGE) and trans-blotted onto siRNA is a positive control targeting both the human and nitrocellulose membranes (Amersham, Piscataway, NJ, USA). mouse MAPK1 genes. AllStars Negative Control siRNA is the Western blot analysis was conducted using antibodies against most thoroughly tested and validated negative control siRNA. human TXNDC5 at a 2,000-fold dilution overnight at 4˚C. The anti-TXNDC5 antibodies that were used were raised in goats Cell proliferation assay. U2OS and HeLa cells were seeded using the oligopeptide SLHRFVLSQAKDEL from TXNDC5. onto 96-well culture plates and incubated until they reached The western signals were visualized using the Protein Detector 80% confluence. The cultures were then treated with TXNDC5 BCIP/NBT Western Blot kit (Beyotime, Haimen, China) siRNA as described above. An MTT [3-(4,5-dimethylthiazol- following the manufacturer's instructions. A separate membrane 2-yl)-2,5-diphenyltetrazolium bromide] assay was performed that was prepared by the same protocol was probed with an 48 h later by adding 100 µl of 1 mg/ml MTT (Amresco, Solon, anti-GAPDH antibody (Santa Cruz Biotechnology, Santa Cruz, OH, USA) mixed with culture media into each well and incu- CA, USA) to normalize the sample loading. bating for 4 h at 37˚C in the dark. The MTT solution was then removed, and the cells were washed twice in PBS followed by air Immunohistochemistry. Tissue arrays were obtained commer- drying. The resulting MTT-formazan products were extracted cially from Chaoying Bioscience (Shanxi, China). The array with 100 µl DMSO in the dark at room temperature, and their slides contained tumor and normal samples from each of the absorbance was measured at 490 nm with a spectrophotometer. following tissues: breast (n=208), cervical (n=33), colon carci- The data were obtained from three independent experiments. noma (n=50), esophageal cancer (n=76), gastric carcinoma (n=84), hepatocellular (n=73), ovarian (n=46), pancreatic Cell migration assay. A cell migration assay was conducted cancer (n=24), prostate cancer (n=54), rectal (n=29) and in a Transwell apparatus (Costar Corning, Corning, NY,