
Supporting Information Liszt et al. 10.1073/pnas.1703728114 Fig. S1. (A) Impact of 1 mM NaHED on gastric motility in the human stomach in the fundus region. Data represent the percentage change of tension before and after adding NaHED. Cholinergically mediated contractions of the tissue were evoked by EFS (200 mA for 0.5 ms at 5 Hz for 10 s every 1 min). Maximum relaxation was detected after 40 min incubation time. (B) Representative traces of the vehicle control and the trace incubated with 1 mM NaHED. Data are given as mean ± SEM. Statistics: vehicle control, n = 2; NaHED, n = 3; t test vs. vehicle control, *P < 0.05. Fig. S2. (A) Bitter intensities of 1,200 mg/L caffeine and 1,200 mg/L caffeine in combination with 240 mg/L HED were assessed in 13 sensorial untrained test subjects under colored light, repeated three or four times. Statistics derived by Student’s t test, **P < 0.01. (B) Reacidification time, measured by the Heidelberg detection system, of different concentrations of caffeine and 125 mL water administered by drinking, allowing activation of oral and gastric TAS2Rs,in comparison with 125 mL water alone. Statistics: Student’s t test, 150 mg caffeine vs. water. (C) Spearman correlation analysis between caffeine bitter intensity and reacidification time after administration of 150 mg caffeine via the drinking protocol. Liszt et al. www.pnas.org/cgi/content/short/1703728114 1of7 Fig. S3. Immunocytochemical costaining patterns of anti-TAS2R10 and epitope tag-specific antibodies in HEK-293T-Gα16gust44 cells. Specific staining of HEK-293T-Gα16gust44 cells expressing TAS2R10 is demonstrated by the TAS2R10 antibody (green). TAS2R10 antibody blocked with specific blocking peptide showed no staining of cells expressing TAS2R10 or in cells expressing irrelevant target TAS2R16. The epitope-tagged receptor proteins were detected using an HSV-specific antiserum (red). Cell surface labeling (blue) was achieved by using con A. Fig. S4. Identification of human gastric cell types by H&E staining in gastric fundus showing localization of gastric cell types (A). Parietal cells are localized in the glands of gastric fundus and body and are scattered in the middle and, to a lesser extent, the bottom part of the mucosa. They are characterized by broad pink cytoplasms. Chief cells stain with basophilic cytoplasm and are mainly located in the bottom parts of the mucosa, which can be seen in more detail inthe Inset: gastric glands with parietal (single arrow) and chief cells (double arrow). (B) Immunohistochemical localization of taste receptor TASR10. Liszt et al. www.pnas.org/cgi/content/short/1703728114 2of7 Fig. S5. Identification of human gastric cell types by H&E staining in gastric antrum (A). (Inset) Detail with gastric glands of antrum. (B) Immunohistochemical localization of taste receptor TASR10 in gastric glands at the bottom part of the mucosa. Liszt et al. www.pnas.org/cgi/content/short/1703728114 3of7 Fig. S6. IPX of HGT-1 cells treated for 10 min with (A) caffeine in different concentrations (n = 5; tr = 6) (B) caffeine alone and in combination with the diluent for ED 1% EtOH. Histamine (HIS) 1 mM was used as positive control (n = 4–37; tr = 6). (C) Caffeine alone and in combination with two concentrations of ED; data displayed as mean ± SEM; n= 4–37; tr = 6, Statistics: (A) one-way ANOVA with Holm–Sídák post hoc test. Significant differences are indicated by ***P < 0.001 or **P < 0.01; *P < 0.05 vs. control. (B and C) One-way ANOVA on ranks with Dunn’s post hoc test. Significant differences are indicated by letters. The lower the IPX, the stronger the proton secretion. Liszt et al. www.pnas.org/cgi/content/short/1703728114 4of7 Fig. S7. (A) Location of the 13-bp deletion in the TAS2R43 gene in the HGT-1 TAS2R43-KO cells established with CRISPR-Cas9–directed KO in comparison with negative control (NC), cells transfected with a nontargeting gRNA, and WT (HGT-1-WT). These results derive from whole-genome sequencing aligned to HG19 and analyzed using IGV software. (B) Verification of deletion also on mRNA level by Sanger sequencing. Liszt et al. www.pnas.org/cgi/content/short/1703728114 5of7 Table S1. Antagonistic or agonistic effect of HED and ED in TAS2Rs-transfected HEK-239T cells TAS2Rs Agonist HED, % ED, % R1 Amarogentin 1 mM —— R3 Chloroquine 3 mM —— R4 Colchicine 3 mM —— R5 1,10 Phenanthroline 300 μM —— R7 Cromolyn 10 mM* —— R8 Chloramphenicol 100 μM —— R9 Ofloxacine 4 mM —— R10 Strychnine 100 μM* —— R13 Denatonium benzoate 3 mM —— † † R14 Azathioprine 300 μM*130130 R16 Salicin 3 mM —— R20 Cromolyn 100 μM30† 20† R30 Denatonium benzoate 100 μM —— † R31 Aristolochic acid 3 μM10— R38 Phenylethyl isothiocyanate (PTC) 30 μM —— R39 Epicatechin gallate 1 mM —— R40 Chlorpheniramine 100 μM —— R41 Chloramphenicol 1 mM —— R43 Aristolochic Acid 0.3 μM*25† 20† R46 Azathioprine 300 μM* —— † † R50 Andrographolide 100 μM2520 The percentage value indicates the extent of inhibition with respect to EC90 agonist-induced activation (e.g., 20% meaning 80% residual activa- tion). Agonist activity was found for TAS2R14. The percentage value refers to the observed response magnitude with respect to the EC90 top agonist- induced activation. The agonists were defined by Meyerhof et al. (10), and concentrations were used according to the results of this publication. Dashes indicate no interaction found. *Caffeine-targeted TAS2Rs are indicated by bold letters. †Significant difference at P < 0.05. Liszt et al. www.pnas.org/cgi/content/short/1703728114 6of7 Table S2. Primers used in this study Gene Direction Sequence (5′ to 3′) Amplicon length, bp TAS2R1 Forward AAATGGCTCCGCTGGATCTC 172 Reverse GTGGCAAGCCAAAGTTCCAA TAS2R3 Forward GGGACTCACCGAGGGGGTGT 160 Reverse CCTCAAGAGTGCCAGGGTGGTG TAS2R4 Forward GCAGTGTCTGGTTTGTGACC 168 Reverse GCGTGATGTACAGGCAAGTG TAS2R5 Forward ACACTCATGGCAGCCTATCC 107 Reverse CGAGCACACACTGTCTTCCA TAS2R7 Forward GCAGGTGTGGATGTCAAACTC 167 Reverse TCTTGACCCAGTCCATGCAG TAS2R10 Forward GCTACGTGTAGTGGAAGGCA 73 Reverse TCCATTCCCCAAAACCCCAA TAS2R13 Forward GAAAGTGCCCTGCCGAGTAT 177 Reverse CCAGATCAGCCCAATTCTGGA TAS2R14 Forward CCAGGTGATGGGAATGGCTTA 128 Reverse AGGGCTCCCCATCTTTGAAC TAS2R19 Forward TCTTAGGACACAGCAGAGCA 146 Reverse AGCGTGTCATCTGCCACAAAA TAS2R20 Forward ATTTGGGGGAACAAGACGCT 183 Reverse ACTACGGAAAAACTTGTGGGAA TAS2R30 Forward GGCTGGAAAAGCAACCTGTC 191 Reverse ACACAATGCCCCTCTTGTGA TAS2R31 Forward TTGAGGAGTGCAGTGTACCTTTC 218 Reverse ACGGCACATAACAAGAGGAAAA TAS2R38 Forward CCCAGCCTGGAGGCCCACATT 216 Reverse TCACAGCTCTCCTCAACTTGGCA TAS2R39 Forward TTCTGTGGCTGTCCGTGTTTA 207 Reverse GGGTGGCTGTCAGGATGAAC TAS2R40 Forward CGGTGAACACAGATGCCACAGATA 150 Reverse GTGTTTTGCCCCTGGCCCACT TAS2R41 Forward GCAGCGAATGGCTTCATTGT 223 Reverse TGGCTGAGTTCAGGAAGTGC TAS2R42 Forward TCCTCACCTGCTTGGCTATC 161 Reverse GGCAAGCCAGGTTGTCAAGT TAS2R43 Forward ATATCTGGGCAGTGATCAACC 148 Reverse CCCAACAACATCACCAGAATGAC TAS2R46 Forward ACATGACTTGGAAGATCAAACTGAG 200 Reverse AGCTTTTATGTGGACCTTCATGC TAS2R50 Forward CGCAAGATCTCAGCACCAAGGTC 151 Reverse GCCTTGCTAACCATGACAACCGGG TAS2R8 Forward ATGTGGATTACCACCTGCCT 135 Reverse GGAAATGGCAAAGCATCCCAG TAS2R9 Forward GCAGATTCGACTGCATGCTAC 70 Reverse TGCCTTTATGGCCCTCATGT TAS2R16 Forward ATGGCATCACTGACCAAGCA 255 Reverse TTTCAACGTAGGGCTGCTCA TAS2R45 Forward AGTACCCTTTACTGTAACCC 170 Reverse AGTAAATGGCACGTAACAAG TAS2R60 Forward GGTGTTCAGTGCTGCAGGTA 156 Reverse CACCTTGAGGAACGACGACT PCR products were verified by sequencing. Primers for TAS2R 45 showed no product in human tongue and HGT-1 cells. Liszt et al. www.pnas.org/cgi/content/short/1703728114 7of7.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages7 Page
-
File Size-