Published OnlineFirst April 12, 2011; DOI: 10.1158/0008-5472.CAN-10-2662 Cancer Tumor and Stem Cell Biology Research Ror1 Is a Pseudokinase That Is Crucial for Met-Driven Tumorigenesis Alessandra Gentile1, Luca Lazzari1, Silvia Benvenuti1, Livio Trusolino2, and Paolo M. Comoglio1 Abstract The human kinome includes Ror1, a poorly characterized orphan receptor. Here we report the findings of an investigation of Ror1 contributions to cancer, undertaken through an integrated screening of 43 cancer cell lines where we measured protein expression, tyrosine phosphorylation, and growth response following RNAi- mediated Ror1 suppression. Ror1 was expressed in approximately 75% of the cancer cell lines without apparent histotype distribution. Gastric carcinoma cells (HS746T) and non–small cell lung carcinoma cells (NCI-H1993) exhibited high levels of Ror1 tyrosine phosphorylation, and Ror1 suppression caused growth inhibition. Biochemical assays revealed unexpectedly that Ror1 is a pseudokinase that is devoid of catalytic activity. Intriguingly, the two cell lines featuring tyrosine-phosphorylated Ror1 both exhibited amplification and activation of the Met oncogene. Ror1 phosphorylation was abrogated by Met inhibition, indicating Met- dependent transphosphorylation of Ror1. Conversely, Ror1 was not transphosphorylated by other constitutively active tyrosine kinases, including EGFR and ErbB2. Constitutive silencing of Ror1 in HS746T and NCI-H1993 carcinoma cells impaired proliferation in vitro and induced a dramatic inhibition of tumorigenesis in vivo. Together, our findings suggest a critical role for Ror1 in malignant phenotypes sustained by the Met oncogene. Cancer Res; 71(8); 3132–41. Ó2011 AACR. Introduction by 2 serine-threonine–rich domains (2). The tyrosine kinase domain of Ror1 is similar to that of Trk and MuSK; however, Receptor tyrosine kinases (RTK) are transmembrane pro- several key amino acids differ from the canonical consensus teins with ligand-controlled intracellular kinase activity. They sequence of active kinases, shedding doubts on the actual play central roles in several cellular processes as diverse as enzymatic function of the receptor. differentiation, proliferation, migration, angiogenesis, survival, On the physiologic ground, the Ror1 protein plays essen- and communication between cells. It has been largely shown tial roles during mouse development (6); it is expressed in that deregulation of RTKs (due to gene amplification, muta- the face, limbs, heart, and lungs. Ror1 knockout mice are tions, transcriptional overexpression, or autocrine stimula- viable, but exhibit respiratory defects and die within 24 tion) is causally linked to the initiation and progression of hours after birth. In humans, Ror1 expression is prevalent human cancers (1). Ror1 belongs to the evolutionarily con- in heart, lung, and kidney (7). The role of Ror1 in disease is served RTK family of Ror, which also includes Ror2 (2). The 2 still obscure; mutations in the Ror1 gene have not been receptors were originally identified by PCR cloning in a human linked to any pathologic condition, and only recently Ror1 neuroblastoma cell line (3). For a long time, their ligands has been found overexpressed in a subset of chronic lym- remained elusive and both receptors were catalogued as phocytic leukemias (8–10). To get insight into the potential "orphans." It is now established that Wnt5A acts a ligand role of Ror1 in solid human cancers, we undertook an RNA for Ror2 (4, 5), whereas the Ror1 ligand remains unknown. interference (RNAi) screen to analyze the effects of Ror1 The Ror1 extracellular region contains an immunoglobulin silencing on cell growth. Unexpectedly, we found that Ror1 is domain, a cysteine-rich domain, and a kringle domain; the a pseudokinase acting as a substrate for the oncogenic intracellular region includes several tyrosines, a putative tyrosine kinase Met; by this function, Ror1 sustains the tyrosine kinase domain, and a proline-rich stretch flanked Met-driven transformed phenotype. Materials and Methods Authors' Affiliations: 1Exploratory Research Laboratory and 2Molecular Pharmacology Laboratory, Institute for Cancer Research and Treatment, Cell cultures and cellular transfection University of Turin Medical School, Candiolo, Turin, Italy Cell lines were obtained from American Type Culture Corresponding Author: Paolo M. Comoglio or Livio Trusolino, Institute for Cancer Research and Treatment, University of Turin, 10060 Candiolo, Collection, National Cancer Institute Division of Cancer Treat- Turin, Italy. Phone: 39-011-9933601; Fax: 39-011-9621525; E-mail: ment and Diagnosis Tumor/Cell line Repository (NCI-Freder- [email protected] or [email protected] ick Cancer Research and Development Center), or Japan doi: 10.1158/0008-5472.CAN-10-2662 Health Sciences Foundation, and cultured according to the Ó2011 American Association for Cancer Research. instructions from cell banks by using the appropriate medium, 3132 Cancer Res; 71(8) April 15, 2011 Downloaded from cancerres.aacrjournals.org on September 30, 2021. © 2011 American Association for Cancer Research. Published OnlineFirst April 12, 2011; DOI: 10.1158/0008-5472.CAN-10-2662 Ror1 Is Crucial for Met-Driven Tumorigenesis 10% FBS (Sigma Aldrich), penicillin/streptomycin solution kit (Applied Biosystems), following the manufacturer's (Sigma Aldrich), and 2 mmol/L L-glutamine (Sigma Aldrich). instructions. Transient transfection of cell lines was carried out by using Quantitative real-time PCR with Sybr Green assay (Applera, Lipofectamine 2000 reagent (Invitrogen), according to the Applied Biosystems) was used to measure the relative amount manufacturer's instructions. of Ror1 cDNA with respect to the amount of a housekeeping gene (PGK). Primers were designed by the Primer Express Reagents, vectors, and antibodies software (Applied Biosystems): Lentiviral shRNA_A, shRNA_B, and nontargeting short hair- Ror1_fw: TGCCAGCCCAGTGAGTAATCT pin RNA (NT_shRNA) are pLKO.1-puro vectors from MISSION Ror1_rev: GCCAATGAAACCAGCAATCTG TRC shRNA Plasmid DNA (product number TRCN0000002024, PGK_fw: CTTATGAGCCACCTAGGCCG TRCN0000002025, and SHC002, respectively). shMET_A has PGK_rev: CATCCTTGCCCAGCAGAGAT already been described (11); shMET_B is a pGIPZ lentiviral vector from Open Biosystems (product number V2LHS_76544). PCR reactions were carried out by a 7900HT sequence Human full-length Ror1 cDNA (NM_005012.1) was purchased detection system (Applera), according to standard protocols. from Origene and was subsequently cloned in the pRRL2 lentiviral vector (12). Ror1 cDNA insensitive to shRNA_A Virus preparation and cell transduction was produced by insertion of 3 point mutations (A2757G, Lentiviral vectors were produced as described (15). Con- C2769G, and T2772C) by QuikChange II XL Site-directed centration of viral particles was assessed by determination of Mutagenesis Kit (Stratagene), according to the manufacturer's the viral p24 antigen concentration by using the HIV-1 p24 instructions. Core profile ELISA kit (Perkin-Elmer Life Science). Cells were The following primers were used (nucleotide mismatch is infected with proper dilutions (1:10 or 1:20) of virus stocks in underlined) for subsequent complete cycles of mutagenesis: the presence of polybrene (8 mg/mL, Sigma), for at least 6 hours. Mut1_fw: CAAAGCAAGCATCTTTGCTAGGAGACGCCAA- TATTC Western blotting analysis and immunoprecipitation Mut1_rev: GAATATTGGCGTCTCCTAGCAAAGATGCTTG- Total cellular proteins were extracted by solubilizing the CTTTG cells in boiling Laemmli Buffer (50 mmol/L Tris-HCl, pH 7.5; Mut2_fw: CAAAGCAAGCATCTTTGCTAGGAGACGCGAA- 150 mmol/L NaCl; and 1% SDS). Immunoprecipitation was CATTCATGGACAC carried out following cell lysis in an Extraction Buffer contain- Mut2_rev: GTGTCCATGAATGTTGGCGTCTCCTAGCAAA- ing 50 mmol/L Hepes (pH 7.4), 5 mmol/L EDTA, 2 mmol/L GATGCTTGCTTTG EGTA, 150 mmol/L NaCl, 10% glycerol, and 1% Triton X-100 in Mut3_fw: GCATCTTTGCTAGGAGACGCGAACATTCATG- the presence of protease and phosphatase inhibitors. Extracts GACAC were clarified at 12,000 rpm for 15 minutes, normalized with Mut3_rev: GTGTCCATGAATGTTCGCGTCTCCTAGCAAA- the BCA Protein Assay Reagent kit (Thermo), and incubated GATGC with different monoclonal antibodies for 2 hours at 4C. Immune complexes were collected with either protein G- All mutations were verified by DNA sequencing. Sepharose or protein A-Sepharose, washed in lysis buffer, The Met inhibitors were from Tocris Bioscience (PHA- and eluted. Extracts were electrophoresed on SDS-polyacry- 665752) and Ortho-Biotech (JNJ-38877605); stock solutions lamide gels and transferred onto nitrocellulose membranes of the drugs were prepared in dimethylsulfoxide and stored (Hybond; GE Healthcare). Nitrocellulose-bound antibodies at À20C. Primary antibodies were goat polyclonal anti-Ror1 were detected by HRP-conjugated secondary antibodies and (R&D Systems); mouse monoclonal anti–phospho-tyrosine enhanced chemiluminescence (GE Healthcare). (anti-pTyr; Upstate Biotechnology); rabbit polyclonal anti– phospho-Met Y1234/Y1235 (Cell Signaling Technology); In vitro kinase assay mouse monoclonal anti-Met DQ13 and DL21, produced in For in vitro kinase assays, Ror1, ErbB2, and ErbB3 proteins our laboratory (13, 14); rabbit polyclonal anti-Met (c-12; Santa were produced by transient transfection of the corresponding Cruz Biotechnology); mouse monoclonal anti-EGFR (Upstate cDNA plasmids in COS-7 cells, extracted in Extraction Buffer Biotechnology); monoclonal trastuzumab anti-ErbB2 (Roche); and then immunoprecipitated