Congenital Stationary Night Blindness; RS: Retinoschisis

Congenital Stationary Night Blindness; RS: Retinoschisis

AIPL1 ALMS1 C2ORF71 C8ORF37 CABP4 CCT2 CEP290 CLUAP1 CNGA3 CNGB3 CRB1 CRX CWC27 CYP1A1 CYP4V2 GUCY2D Isolated_LCA IFT140 IMPDH1 IQCB1 KCNJ13 KCNV2 KRT12 LCA5 LRAT MERTK MPDZ NMNAT1 NR2E3 OFD1 OTX2 PDE6G PRPH2 RD3 RDH12 RPE65 RPGRIP1 SPATA7 TULP1 AHI1 ALMS1 ARL13B C21ORF2 C5ORF42 CC2D2A CEP104 CEP164 Syndromic_LCA CEP290 CEP41 CSPP1 IFT140 INPP5E INVS IQCB1 KIF7 LCA5 NPHP1 NPHP3 NPHP4 POC1B RPGRIP1L SDCCAG8 TMEM138 TMEM216 TMEM237 TTC8 TUBB4B VPS13B WDR19 ZNF423 ATF6 CACNA1F CACNA1F CCT2 CLN1/PPT1 CLN2/TPP1 CLN3 CLUAP1 Differential_Diagnosis_LCA CNGA3 CNGB3 GNAT1 GNAT2 GPR179 GRM6 LRIT3 NYX PDE6C PDE6H PRPH2 SLC24A1 SLC38A8 TRPM1 ABCA4 ABHD12 ADIPOR1 AGBL5 AHI1 ARL2BP ARL6 BBS1 BBS2 BBS5 BBS12 BEST1 C2ORF71 C8ORF37 C21ORF2 CA4 CACNA1F CC2D2A CEP250 CEP290 CEP78 CERKL CHM CLN3 CLRN1 CNGA1 CNGB1 CRB1 CRX CWC27 CYP4V2 DHDDS DHX38 EXOSC2 EYS FAM161A FLVCR1 FSCN2 GNAT1 GNPTG GPR125 GUCA1B HGSNAT HK1 IDH3A IDH3B IFT43 IFT140 IFT172 IMPDH1 IMPG2 IQCB1 ITM2B KIAA1549 KIZ KLHL7 Rod_Cone LAMA1 LRAT MAK MERTK MFRP MFSD8 MPDZ NEK2 NEUROD1 NPHP4 NR2E3 NRL OFD1 OPN1SW OR2W3 PCYT1A PDE6A PDE6B PDE6G PIK3R4 PITPNM3 POMGNT1 PRCD PROM1 PRPF3 PRPF31 PRPF4 PRPF6 PRPF8 PRPH2 RBP3 RCBTB1 RDH11 RDH12 REEP6 RGR RHO RIMS1 RIMS2 RLBP1 ROM1 RP1 RP1L1 RP2 RP9 RPE65 RPGR RPGRIP1 SAG SEMA4A SLC7A14 SLC24A1 SNRNP200 SPATA7 SRD5A3 TOPORS TTC8 TTLL5 TTPA TUB TULP1 USH2A WDR19 ZNF408 ZNF513 ABCA4 ABHD12 ACBD5 ADAMTS18 ADAM9 AIPL1 ALMS1 ATF6 BBS1 BBS5 C2ORF71 C8ORF37 C21ORF2 CABP4 CACNA2D4 CDHR1 CEP78 CERKL CNGA3 CNGB3 CNNM4 CRX FAM161A GNAT2 Cone_Rod GUCA1A GUCY2D KCNV2 LCA5 NMNAT1 NR2E3 PCYT1A PDE6C PDE6H PITPNM3 POC1B PROM1 PRPH2 RAB28 RASSF8 RAX2 RDH5 RDH12 RIMS1 RIMS2 RPE65 RPGR RPGRIP1 SEMA4A SPATA7 SRD5A3 TTLL5 TULP1 UNC119 USH2A ABCA4 ATXN7 BEST1 C1QTNF5 CDH3 CNGA3 CRB1 DRAM2 Macular_Dystrophy EFEMP1 ELOVL4 FSCN2 GUCA1A GUCA1B IMPG1 IMPG2 MFSD8 PROM1 PRPH2 RLBP1 RP1L1 RPGR TIMP3 ATF6 CACNA1F CLUAP1 CNGA3 CNGB3 GNAT2 NDP PDE6C Achromatopsia PDE6H Dyschromatopsies OPN1LW OPN1MW OPN1SW CABP4 CACNA1F GNAT1 GNB3 GRK1 GPR179 GRM6 HK1 CSNB LRIT3 NYX PDE6B RHO SAG SLC24A1 TRPM1 RS RS1 CRB1 Choroideremia CHM Others PAX2 RBP4 GPATCH11 Figure S1. Panel of 199 genes involved in retinal dystrophies. LCA: Leber congenital amaurosis; CSNB: congenital stationary night blindness; RS: retinoschisis. Figure S2. Localization of primers used to amplify the full‐length and CEP290 mRNAs lacking exon 36. In blue, RT‐PCR primer pairs used to amplify the full‐length and skipped CEP290 transcripts. In orange, RT‐qPCR primer pairs used to amplify the full‐length (wild‐type, WT or Mutant) CEP290 transcript. In red, RT‐qPCR primer pairs used to amplify the CEP290 transcript deleted of exon 36 (CEP290Δ36), respectively. Table S1. Sequences and positions of sequencing primers. Targeted region Couple Position Sequence (5’>3’) forward Intron 35 ACAATTTAAGATATAGTTTCG CEP290 Exon 36 reverse Intron 36 AACAAAAAGGGTAACTTC Table S2. Genetic and clinical features of individuals. Age* CEP290 Ocular Individual Cell line Gender (years) mutations phenotype Control 1 C1 Female 8 None No overt pathology Control 2 C2 Male 10 None No overt pathology Control 3 C3 Female 13 None No overt pathology c.4723A>T (p.Lys1575*) Patient 1 P1 Male 34 EOSRD c.4723A>T (p.Lys1575*) c.4723A>T (p.Lys1575*) Patient 2 P2 Male 24 LCA c.4723A>T (p.Lys1575*) EOSRD: Early onset and severe retinal dystrophy; LCA: Leber congenital amaurosis *age at which the dermal biopsy and the last clinical examination were performed. Table S3. Sequences and positions of RT‐PCR primers. Targeted region Couple Position Sequence (5’>3’) forward Exon 35 CCACTGCAGAAAGAGAAAAGC CEP290 Exon 36 reverse Exon 37 TTAGTTTGACCAAGAGTGAGGAA Table S4. Sequences and positions of RT‐qPCR primers. ʺFull‐lengthʺ refers to the wild‐type or mutant CEP290 transcript, whereas CEP290Δ36 refers to CEP290 transcript deleted of exon 36. Targeted region Couple Position Sequence (5’>3’) « full‐length » forward Jonction exon 36/exon 37 AACAAACGGCTTGGGATTTAATGA CEP290 (exon 36) reverse Exon 37 TTTGACCAAGAGTGAGGAAAGAGA forward Jonction exon 35/exon 37 AAAGCCAGAGAGGATTTAATGAAAC CEP290Δ36 reverse Exon 37 TTGACCAAGAGTGAGGAAAGAG .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    3 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us