NOTE Eur. J. Entomol. 103: 709–715, 2006 ISSN 1210-5759 Preliminary phylogeny of Tribolium beetles (Coleoptera: Tenebrionidae) resolved by combined analysis of mitochondrial genes NEVENKA MEŠTROVIû, BRANKICA MRAVINAC, MIROSLAV PLOHL, ĈURĈICA UGARKOVIû and BRANKA BRUVO-MAĈARIû* Ruÿer Boškoviü Institute, Bijeniþka 54, HR-10002 Zagreb, Croatia Key words. Tribolium, mitochondrial DNA, cytochrome oxidase I, 16S rDNA, phylogeny, sibling species Abstract. The phylogenetic relationships of the three major species groups of Tribolium (Coleoptera: Tenebrionidae) were inferred using the simultaneous analysis of 642 bp of the most conserved part of mitochondrial DNA (mt DNA) cytochrome oxidase I (COI) and 448–452 bp of mt 16S rDNA. High sequence divergence was observed for both genes even among sibling species. The analysis of the combined segments of COI and 16S rDNA sequences produced a phylogenetic tree with moderate level of confidence. The tree topology showed monophyly of the genus Tribolium whose species were separated into three groups: “brevicornis” group (with T. brevicornis as the only representative), “castaneum” group (with T. castaneum, T. freemani, T. madens and T. audax) and “con- fusum” group (with T. confusum, T. anaphe and T. destructor). Sibling species pairs T. castaneum – T. freemani and T. madens – T. audax are clearly resolved. The preliminary results presented here give moderate support to the previously proposed phylogeny based on morphological data. INTRODUCTION disagreement with cytological and morphological data. A com- parison of the defensive secretions from Tribolium species indi- The genus Tribolium Macleay, 1825 belongs to the family cated that “brevicornis” and “castaneum” are sister species Tenebrionidae (order Coleoptera) and comprises 33 described groups, and that T. brevicornis and T. audax are members of the species (Sokoloff, 1972), several of which are important stored same species group (Howard, 1987). product pests. Some of the species are easily cultured in the To our knowledge, there has been no study of this genus so laboratory and the genus has been extensively used in genetic far that would be based on phylogenetically informative analyses (Sokoloff, 1972; Beeman et al., 1996; Bennett et al., molecular data. At the DNA level, relationships between some 1999; Brown et al., 2000). Thanks to its convenient genetic Tribolium species were inferred using characteristics of highly set-up, Tribolium castaneum is predisposed to become one of repetitive DNAs, their sequence homology and abundance (Juan the three most important insect model systems beside Droso- et al., 1993; Ugarkoviü et al., 1996). The cladogram obtained phila and Bombyx mori (Schmidt & Tautz, 1999; Brown et al., from satellite DNA hybridization data, karyological data and 2003; Nagaraju & Goldsmith, 2002). chemical compounds of secretion (Juan et al., 1993) supported Several studies have attempted to establish evolutionary the “castaneum” species-group, although T. audax was placed trends in these beetles. According to morphological characters, outside of this group, while “confusum” and “brevicornis” Hinton (1948) divided Tribolium species into five groups: species-groups appeared as sister clades, in contrast to the phy- “brevicornis” group (considered as the most primitive), “con- logeny proposed by Hinton (1948) and Howard (1987). fusum”, “alcine”, “castaneum” and “myrmecophilum” group. In this work we address the phylogenetic relationships among According to Hinton, the first four groups separated in the Cre- the eight most studied species of Tribolium: T. castaneum, T. taceous period, while the “myrmecophilum” group separated confusum, T. destructor, T. madens, T. audax, T. anaphe, T. from the “castaneum” group in the Quaternary. The “brevi- freemani and T. brevicornis, which are also the most widespread cornis”, “castaneum” and “confusum” species-groups are pre- and economically important. These eight species represent, dominant in the number of species and their distribution, and according to Hinton (1948), three major species groups: the can be further split into sections. The remaining two groups “castaneum” group (T. castaneum, T. audax, T. freemani and T. comprise only five species that are geographically restricted to madens), the “confusum” group (T. confusum, T. anaphe, T. Australia and Madagascar. Within Tribolium, even the sibling destructor) and the “brevicornis” group (T. brevicornis). Despite species T. madens – T. audax and T. castaneum – T. freemani, our efforts, we were unable to get hold of any of the additional able to hybridize, are morphologically distinguishable by “brevicornis” group species, nor any of the species belonging to numerous characters pointing to a high species divergence in the “alcine” and “myrmecophilum” groups, and therefore we regard group (Halstead, 1969; Wade & Johnson 1994). this study as an initial and preliminary analysis of Tribolium Cladistic relationships among some Tribolium species phylogeny. In order to resolve the relationships of these eight inferred from cytological studies of chromosome numbers, species we used two genes that are regarded as the most con- revealed the “castaneum” group as more “primitive” than the served among mitochondrial markers routinely used for phylo- “confusum” group (Smith, 1952). Evolutionary relationships of genetic inference: cytochrome oxidase I (COI) and 16S rDNA. the most common Tribolium species were also studied by elec- COI has been used for phylogenetic inference of many insects trophoretic analysis of isozymes (Wool, 1982). According to (Lunt et al., 1996) – the variable part of this gene has been used this study, T. castaneum and T. confusum are more closely to deduce phylogenetic relationships among congeneric species related to T. brevicornis than they are to each other, which is in * Corresponding author; e-mail: [email protected] 709 of the tenebrionid genera Pimelia and Hegeter (Juan et al., GapCoder (Young & Healy, 2002). The matrices obtained this 1995, 1996; Pons et al., 2004). However, this part of the COI way were then used in both parsimony and Bayesian searches. gene appeared to be too variable for phylogenetic reconstruction The alignments used in phylogenetic analyses are available on within the tenebrionid genus Palorus (Meštroviü et al., 2000), a request from the authors. taxon closely related to the genus Tribolium. For this reason, we COI and 16S rDNA data sets were tested using the partition decided to use the most conserved part of the COI gene, pro- homogeneity test (Farris et al., 1994) implemented within PAUP posed by Zhang & Hewitt (1997) to be suitable for low- and mid to assess whether combining of COI and 16S sequences is level phylogenetic analysis. The other phylogenetic marker used appropriate for phylogenetic analysis. Phylogenetic analyses in this study, 16S rDNA, appears to be at least twice as con- were performed on separate and combined datasets by parsi- served as COI gene in species of the order Coleoptera (Funk, mony (MP) and maximum likelihood (ML) searches using 1999; Garin et al., 1999). PAUP 4.0b10 (Swofford, 1998), and by Bayesian analysis with Markov Chain Monte Carlo (MCMC) sampling in MrBayes 3.1 MATERIAL AND METHODS (Huelsenbeck & Ronquist, 2001). Beetle material For MP analyses, we used the heuristic search with tree- bisection-reconnection (TBR) branch-swapping option. The Insect cultures (laboratory strains) used in this study were extent of support for internal nodes was estimated using the obtained from the Central Science Laboratory (Sand Hutton, bootstrap method (1000 pseudoreplicates) (Felsenstein, 1985). York, UK). A natural population of the species T. madens was Bremer support and partitioned Bremer support values (Baker & collected in a flourmill (Virovitica, northern Croatia). Total DeSalle, 1997) were calculated based on strict consensus MP DNA was extracted from a single individual according to trees using the program TreeRot 2 (Sorenson, 1999). Steiner et al. (1995), or from pooled individuals following the The model of DNA substitution was determined for each gene standard protocols. with the program MODELTEST 3.04 (Posada & Crandall, PCR amplification and sequencing 1998). The estimated parameters (GTR+G+I, being the model Parts of COI were amplified using primers C1-J-2090 (UEA5) preferred by both Akaike information criterion (AIC) and hier- (5'AGTTTTAGCAGGAGCAATTACTAT3') and C1-N-2738 archical likelihood ratio test (hLRT) for both partitions) were (UEA8) (5'AAAAATGTTGAGGGAAAAATGTTA3') (Zhang then invoked for ML heuristic searches with simple sequence & Hewitt, 1997). These primers amplify about 690 bp of the addition and TBR branch-swapping option. COI gene, corresponding to sites 1747 and 2392 of the Droso- Bayesian MCMC analyses with four parallel Markov chains phila yakuba mitochondrial genome. Primers LR-N-13388 were run under the GTR+G+I model (unlinked parameters for (5'CGCCTGTTTATCAAAAACAT3') and a modified LR-J- each partition, overall rate allowed to be different across parti- 12887 (5' CTCCGGTTTGAACTCAGATCA3') (Simon et al., tions) for 1000000 generations, with sampling frequency of one 1994) were used to amplify a segment of about 550 bp of the in every hundred trees. The consensus tree (with posterior prob- mitochondrial 16S ribosomal DNA. Sequences of 16S rDNA abilities for each node as a measure for support) was constructed from T. madens were amplified with internal primers (LR-J1: based on the trees sampled after the convergence of likelihood 5’GTAAAATTTTAAAGGTCGAACAGACC3’