
Identification of reproduction related gene polymorphisms using whole transcriptome sequencing in the Large White pig population Daniel Fischer*, Asta Laiho§, Attila Gyenesei†, and Anu Sironen*1 *Natural Resources Institute Finland (Luke), Green Technology, Animal and Plant Genomics and Breeding, FI‐31600 Jokioinen, Finland. §The Finnish Microarray and Sequencing Centre, Turku Centre for Biotechnology, University of Turku and Åbo Akademi University, Tykistökatu 6, FI‐20520 Turku, Finland. †Campus Science Support Facilities, Vienna Biocenter, A‐1030 Vienna, Austria Corresponding author: 1Natural Resources Institute Finland (Luke), Green Technology, Animal and Plant Genomics and Breeding, Myllytie 1, FI‐31600 Jokioinen, Finland. email: [email protected] DOI: 10.1534/g3.115.018382 Figure S1 Biological processes of the 80 genes with the highest expression in the testis and oviduct. A. Spermatogenesis related terms were enriched in the highly expressed genes in the testis. B. 53 genes were specifically highly expressed in the testis and oviduct and 27 genes in both out of 80 genes with the highest expression in these tissues. C. Enriched GO terms of highly expressed genes in the oviduct. D. Distribution of highly expressed genes in the testis and oviduct between biological processes. AgriGO was used for analysis of GO term enrichment (A and C) and Panther (human genes) for identification of biological processes in the highly expressed gene group in both tissues (D). 2 SI D. Fischer et al. Figure S2 Identified hits between the pig and cow, human and sheep. A. Hit locations between the pig and cow genome. B. Hit locations between the pig and human genome. C. Hit locations between the pig and sheep genome. The exonic hits are shown in red and intronic in green. D. Venn diagram of the identified hits between cow (BT), human (HS) and sheep (OA). E. Details on novel ortholog hits in cow, human and sheep. Total hits give the total amount of hits in one of the target organisms and intergenic, intronic and exonic give details on the exact location. If the hit overlaps in any way an exon it is counted for the numbers in brakets. Numbers without brackets are the counts in case that the hit is entirely included in the hit exon. D. Fischer et al. 3 SI Figure S3 Annotation of MCL1 gene. A. The identified polymorphism in the MCL1 gene appears to be an annotation error. The annotation of the gene is incomplete based on the expressed reads in the testis and oviduct. B. The comparison of the protein sequence of MCL1 between the human, pig_Ensembl and pig_seq, where pig_Ensembl corresponds to the annotated MCL1 and pig_seq to our expression data. 4 SI D. Fischer et al. Table S1 Gene specific primers for RT‐PCR and Sanger sequencing. Forward Reverse Product length PGR ACAGGAACCAGACGGGAAG GATGGGCACGTGGATAAAAT 724 ADAT1 CCGAGGTCATAGCCAGAAGA TCGGGGGCTTTTAGGTTATT 280 SPAG6 CCGGTCCTGCTTTCTTTGTA AAAAGTCGTCGTGCTTTGCT 209 PIWIL2 AGGCCTCTTTTGGTTGGAAT TTCCTTTTGATCCTTGCTTCA 303 DNAH8 CAATGCCAAAACCTCAGTCA GAACTCCTCCTGAGCCATGT 328 TCF4 GCCGAATCGAAGATCGTTTA TTCAAATCAGGGGAAGTTGC 131 FRAS1 CCACACCGAGATGGAGTTTT CGTGGCTCTCCAGAGTTGAT 313 RIBS18 ATCCCTGAGAAGTTCCAGCA ACACGTTCCACCTCATCCTC 188 D. Fischer et al. 5 SI Table S2 Genes with the highest expression (n=80) in the testis and oviduct. gene_short_name oviduct_FPKM ATP8A1 76606.1 LOC100157883 73188.5 LOC100513756 64485.4 LOC100622834 54652.1 PLAGL1 44093.5 LOC100157935 35359.2 LOC100516642 31448.9 LOC100518227 16218.6 LOC100514340,MIR143,MIR145 11169.5 IBA57 9471.31 DDX4 8910.9 PNLIPRP1 7712.98 EEF1A1 7242.4 LOC100622573 6107.16 LOC100625292 5815.59 LOC100520667 5664.21 TMEM145 5290.06 MPZL2 5006.76 LOC100517534 4479.83 ACTA2 3961.24 TMSB4X 3237.01 LOC100627665 3081.72 MGP 2880.89 RPS21 2873.95 MIR4336 2568.61 CLDN1 2553.89 LOC100525692 2466.84 MYLK 2273.83 LOC100522027 2134.26 MYL9 2086.79 TAGLN 2070.83 DES 2058.99 COL3A1 1589.61 LOC100622481 1571.15 ACTB 1565.39 DSTN 1553.49 FTH1 1475.43 LOC100526209 1432.25 MYL6 1404.12 OVGP1 1364.18 LOC100621455 1305.62 LOC100522136 1291.3 PLTP 1262.42 GAPDH 1217.26 6 SI D. Fischer et al. LOC100621129 1206.85 TPM2 1197.49 MIR99A,MIRLET7C 1189.17 SPARC 1133.82 LOC100737811 1126.09 LOC100620683 1122.37 HSPCB 1109.15 EEF2 1067.47 LOC100524583 1017.11 RPS17 945.382 LOC100524282 906.364 SUMO1 876.473 CNN1 873.427 LOC100515911 872.617 LOC100516861 859.36 RPS3 848.006 COL1A2 814.28 LTBP1 806.824 RPL11 770.716 TPM1 768.249 RPL35 735.498 LOC100511977,LOC100512151 731.21 SLPI 719.409 LOC100622613 708.73 RPL8 708.433 EEF1G 699.431 EEF1B2 699.01 LOC100522521 680.548 LOC100514795 673.396 LOC100523300 672.361 LOC100627561 653.074 RPL17 633.095 RPS4 632.59 LOC100736789 630.743 LOC100737020 629.655 ACTB 625.165 gene_short_name testis_FPKM LOC100517827 74760 LOC100622573 26267.6 PNLIPRP1 15774 PRM1 10456.1 LOC100513764 9829.46 ATOX1 9467.19 ATP8A1 8026.95 PLAGL1 7381.05 LOC100516642 6930.04 D. Fischer et al. 7 SI LOC100157935 6772.96 MPZL2 6157.16 LOC100522592 5538.98 LOC100157883 4620.02 MIR4336 4581 LOC100623777 4422.77 MYRIP 3799.71 LOC100513756 3718.02 LOC100518227 3236.04 ADRA2C 2990.01 LOC100526209 2962.74 KLHL4 2832.95 RPS21 2530.94 CCPG1 2458.25 LOC100627561 2087.27 LOC100623109 2005.07 LOC100520393 1970.85 LOC100625292 1810.06 LOC100152135 1724.94 ADAM32 1618.98 LOC100524041 1466.76 EEF1A1 1445.86 INSL3 1384.54 LOC100514231 1358.36 IBA57 1227.13 LOC100152878 1215.45 LOC100525692 1195.07 PRM2 1149.37 LOC100517534 1104.91 LOC100514340,MIR143,MIR145 1050.43 LOC100739143 1023.52 LOC100620512 1000.49 FTH1 942.108 DDX4 937.067 CRISP2 892.375 OAZ3 882.427 LOC100739189 877.945 LOC100739452 855.828 CCDC91 841.578 LOC100627665 832.745 UCHL3 816.889 PHF7 810.748 GATA2 732.685 COX7A2 721.625 CA9 688.404 LOC100511711 684.121 8 SI D. Fischer et al. ODFP 676.682 PGAM2 675.168 LOC100623886 664.939 UBB 658.896 LOC100521985 651.605 TNP2 649.089 UBA52 632.133 LOC100515753 607.879 CYP17A1 604.315 ANKRD35 591.485 TXNDC8 590.583 GPX4 568.021 LOC100516302 556.086 LOC100621455 549.4 LOC100524282 547.305 LOC100518125 518.236 LOC100513730 515.48 SGK3 511.186 LOC100620683 497.67 LOC100736789 488.973 TMEM145 487.203 LOC100627250 486.369 LOC100621326 473.168 LOC100523863 467.962 EEF1G 467.696 D. Fischer et al. 9 SI Table S3 Genes with the highest fold change (n=30) between the testis and oviduct. gene locus oviduct testis log2.fold_change p_value q_value INSL3 2:59499022‐59501035 0.688437 1384.54 10.9738 1.54E‐09 4.45E‐07 CRISP2 7:50064948‐50084206 0.533707 892.375 10.7074 1.87E‐05 0.000919 OAZ3 4:106462911‐106467162 1.22288 882.427 9.49506 0.000100433 0.003399 ODFP 4:37337098‐37346864 0.746396 676.682 9.82432 2.96E‐05 0.001317 LOC100515753 12:22758581‐22763289 1.68122 607.879 8.49813 6.53E‐12 5.40E‐09 MEA1 7:43503955‐43528669 13.8831 353.43 4.67002 0.00350841 0.045763 LOC100518240 2:58285602‐58287001 0.191882 288.734 10.5553 9.69E‐12 7.44E‐09 LOC100624194 8:108829906‐108871885 0.130904 230.902 10.7846 1.60E‐07 1.92E‐05 LOC100517496 13:79559454‐79560409 0.182177 214.102 10.1987 1.41E‐10 6.78E‐08 SPAG6 10:58151594‐58226625 3.76465 203.638 5.75734 0.00110784 0.020199 ZPBP 9:149631159‐149713232 1.10651 170.401 7.26677 5.51E‐05 0.00212 ZPBP2 12:22912390‐22921116 0.523879 155.714 8.21545 8.05E‐09 1.74E‐06 LOC100627282 6:18145373‐18159195 0.318012 152.798 8.90833 4.32E‐09 1.04E‐06 PIWIL1 14:26192313‐26220115 0.142045 150.54 10.0496 1.91E‐08 3.52E‐06 TSPAN6 X:90165046‐90170667 2.49119 134.351 5.75303 1.23E‐08 2.48E‐06 LOC100515522 1:264620240‐264622172 0.206198 131.137 9.31282 3.06E‐12 2.96E‐09 PKDREJ 5:508107‐520565 1.19459 126.24 6.72351 5.03E‐05 0.001982 LOC100158105 1:242534738‐242561812 0.100638 118.984 10.2074 3.31E‐07 3.56E‐05 TCP11 7:35783077‐35844345 0.291547 114.433 8.61656 2.20E‐12 2.28E‐09 LOC100516911 5:92078224‐92091501 0.510305 113.321 7.79484 6.77E‐07 6.42E‐05 LOC100512378 17:14626199‐14631976 0.287357 77.2239 8.07006 0.000813554 0.016202 LOC100625706 13:4036634‐4056819 0.071568 70.4843 9.94377 5.44E‐08 8.07E‐06 PLCZ 5:57679478‐57724921 0.060533 62.9571 10.0224 6.26E‐05 0.002343 LOC100155042 15:112635232‐112667726 0.079973 61.273 9.58152 0.000122248 0.003929 FSCN3 18:21688293‐21697295 0.053908 61.152 10.1477 1.67E‐05 0.000845 DNAJB13 9:9131927‐9144855 2.65254 55.2483 4.38048 5.78E‐06 0.000366 ADAM29 14:16572820‐16582496 0.018563 50.462 11.4085 0.000169448 0.005039 SPATA4 15:44398722‐44405669 0.234684 48.9452 7.70431 2.95E‐06 0.00021 LOC100620897 5:42201615‐42217298 0.055939 45.4034 9.66473 0.00160601 0.026527 LOC100520622 7:80362314‐80364915 1.69136 43.4496 4.68308 0.00123991 0.021976 LOC100526087 18:7984221‐7991205 0.177518 41.8197 7.88008 2.17E‐06 0.000166 LOC100519590 2:70437559‐70447688 0.402181 38.1662 6.56831 1.12E‐05 0.000623 STAR 15:55502045‐55510264 0.120995 37.514 8.27633 1.29E‐08 2.56E‐06 CCNB2 1:124906586‐124942507 0.88183 36.0211 5.3522 0.00149299 0.025215 MTL5 2:2877079‐2921570 0.195353 35.6701 7.51249 1.15E‐06 9.94E‐05 CCNB1 16:51155614‐51165760 2.2276 32.1369 3.85067 0.000475909 0.010972 TESK2 6:153280243‐153411931 1.83731 30.4592 4.05121 0.000341638 0.008575 NR6A1 1:299188177‐299395773 1.56266 24.9798 3.99868 0.000164625 0.004923 PIWIL2 14:6997764‐7064827 0.618911 22.6533 5.19385 0.000302952 0.007839 ZNF389 7:23945770‐23950386 3.31984 19.8518 2.58008 0.00164791 0.027083 CCNE1 6:35242726‐35255441 1.17288 18.9009 4.01032 1.42E‐05 0.000745 DNAH8 7:39286020‐39569424 0.157725 15.451 6.61415 0.000780441 0.015739 LOC100512876 X:23597855‐23600361 0.01532 14.6241 9.89872 1.87E‐05 0.00092 CCNJ 14:117155742‐117174116 1.04406 12.6765 3.60189 7.95E‐05 0.002809 10 SI D.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages19 Page
-
File Size-