Published OnlineFirst November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0263 DNA Damage and Repair Molecular Cancer Research Linking Cancer Metabolism to DNA Repair and Accelerated Senescence Elena V. Efimova1,2, Satoe Takahashi1,2, Noumaan A. Shamsi3, Ding Wu1,2, Edwardine Labay2,4, Olesya A. Ulanovskaya3, Ralph R. Weichselbaum2,4, Sergey A. Kozmin3, and Stephen J. Kron1,2 Abstract Conventional wisdom ascribes metabolic reprogramming in ase reversed GlcNAc's effects. Opposing the HBP, TCA meta- cancer to meeting increased demands for intermediates to bolites including a-ketoglutarate blocked DSB resolution. support rapid proliferation. Prior models have proposed ben- Strikingly, DNA repair could be restored by the oncometabolite efits toward cell survival, immortality, and stress resistance, 2-hydroxyglutarate (2-HG). Targeting downstream effectors of although the recent discovery of oncometabolites has shifted histone methylation and demethylation implicated the PRC1/2 attention to chromatin targets affecting gene expression. To polycomb complexes as the ultimate targets for metabolic explore further effects of cancer metabolism and epigenetic regulation, reflecting known roles for Polycomb group proteins deregulation, DNA repair kinetics were examined in cells trea- in nonhomologous end-joining DSB repair. Our findings that ted with metabolic intermediates, oncometabolites, and/or epigenetic effects of cancer metabolic reprogramming may metabolic inhibitors by tracking resolution of double-strand promote DNA repair provide a molecular mechanism by which breaks (DSB) in irradiated MCF7 breast cancer cells. Disrupting deregulation of metabolism may not only support cell growth cancer metabolism revealed roles for both glycolysis and glu- but also maintain cell immortality, drive therapeutic resistance, taminolysis in promoting DSB repair and preventing acceler- and promote genomic instability. ated senescence after irradiation. Targeting pathways common to glycolysis and glutaminolysis uncovered opposing effects of Implications: By defining a pathway from deregulated metabo- the hexosamine biosynthetic pathway (HBP) and tricarboxylic lism to enhanced DNA damage response in cancer, these data acid (TCA) cycle. Treating cells with the HBP metabolite N- provide a rationale for targeting downstream epigenetic effects of acetylglucosamine (GlcNAc) or augmenting protein O-GlcNA- metabolic reprogramming to block cancer cell immortality cylation with small molecules or RNAi targeting O-GlcNAcase and overcome resistance to genotoxic stress. Mol Cancer Res; 14(2); each enhanced DSB repair, while targeting O-GlcNAc transfer- 173–84. Ó2015 AACR. Introduction needed to support rapid cancer cell growth (3, 4). In turn, gluta- mine "addiction" in cancer, first observed by Eagle as an elevated Otto Warburg was first to describe a diminished Pasteur effect in requirement for cells in culture (5), has similarly been ascribed to tumors, which actively take up and ferment glucose even in the answering increased demand for building blocks for cell prolifer- presence of oxygen (1). Prior models ascribed deregulated glucose ation (6–8). Beyond biosynthesis, recent attention has focused fermentation in cancer cells primarily to compensation for mito- on potential regulatory functions for metabolic intermediates chondrial defects or adaptation to tumor hypoxia (2), but the focus produced by glycolysis and/or glutaminolysis, via their roles as has shifted to roles for metabolic products beyond ATP. Indeed, co-factors and inhibitors of chromatin-modifying enzymes aerobic glycolysis promotes accumulation of intermediates that (9–12). Relevant chromatin-modifying enzyme/coenzyme pairs can serve as precursors for the proteins, lipids, and nucleic acids include histone acetyltransferase (HAT) and acetyl-CoA, PARP and þ NAD , histone lysine methyltransferases (HMT) and S-adenosyl 1Department of Molecular Genetics and Cell Biology,The University of methionine, Jumonji-domain containing histone lysine demethy- Chicago, Chicago, Illinois. 2Ludwig Center for Metastasis Research, lases (JmjC HDM) and a-ketoglutarate (a-KG), O-linked N-acetyl- The University of Chicago,Chicago, Illinois. 3Department of Chemistry, glucosamine (O-GlcNAc) transferase (OGT) and GlcNAc, and, of The University of Chicago, Chicago, Illinois. 4Department of Radiation and Cellular Oncology, The University of Chicago, Chicago, Illinois. course, Ser/Thr and Tyr protein kinases and ATP. These considera- tions have raised the hypothesis that via its epigenetic effects, Note: Supplementary data for this article are available at Molecular Cancer cancer metabolic reprogramming may influence gene expression Research Online (http://mcr.aacrjournals.org/). to drive oncogenesis and maintain cancer cell identity. For exam- fi E.V. E mova and S. Takahashi contributed equally to this article. ple, glycolytic metabolism in cancer cells impacts global chromatin Corresponding Author: Stephen J. Kron, University of Chicago, Gordon Center structure by modulating histone acetylation (13), potentially for Integrative Sciences, 929 East 57th Street, GCIS W522A, Chicago, IL 60637. altering transcription but also impinging on DNA repair. Indeed, Phone: 773-834-0250; Fax: 773-834-1815; E-mail: [email protected] along with their well-studied roles in epigenetic regulation of doi: 10.1158/1541-7786.MCR-15-0263 transcription, HATs, PARPs, and HMTs are also key regulators of Ó2015 American Association for Cancer Research. DNA damage response (DDR; ref. 14), suggesting a mechanism by www.aacrjournals.org 173 Downloaded from mcr.aacrjournals.org on September 30, 2021. © 2016 American Association for Cancer Research. Published OnlineFirst November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0263 Efimova et al. which cancer metabolism might directly influence genomic insta- unless otherwise noted and IRIF persistence was evaluated at bility and resistance to genotoxic stress. 24 hours. Control, nonirradiated cells treated with each inhib- In particular, specific patterns of histone modification are itor or metabolite were examined at 24 hours to confirm lack of associated with ionizing radiation induced foci (IRIF), the multi- toxicity and no increase in IRIF formation. In turn, cells treated kilobase chromatin domains that form rapidly at sites of chro- with inhibitors or metabolites were examined at 2 hours after mosomal double-strand breaks (DSB) and mark eroded telo- irradiation to detect any suppression of IRIF formation. meres (15–18). Although DSBs are difficult to visualize in intact For imaging, cells were fixed with 2% paraformaldehyde in nuclei, IRIF are easily detected and can serve as a proxy for DNA PBS for 5 minutes, followed by two washes with PBS. Slides damage (19). To probe the interaction of cancer metabolism and were mounted with ProLong Gold (Invitrogen) after staining with DNA repair, we used small molecule inhibitors, cell-permeable 5 mg/mL Hoechst 33342 (Sigma) or mounted with SlowFade metabolic intermediates, and RNAi to perturb metabolic path- Gold anti-fade reagent with DAPI (Invitrogen). Images were ways in MCF7 breast adenocarcinoma cells. We observed that captured on a Zeiss Axiovert 40 CFL microscope with a 40Â inhibition of glycolysis before irradiation allowed IRIF to form Plan-Neofluar objective and Axiocam digital camera controlled but blocked their timely resolution. Detecting residual DNA by AxioVision 4.8 software and pseudo-colored in Adobe Photo- breaks by comet assays confirmed a defect in DSB repair. In the shop or ImageJ (http://imagej.nih.gov/ij/). Numbers of foci face of persistent damage, rather than undergoing apoptosis, per nucleus were determined using ImageJ, and means Æ SEM many cells entered accelerated senescence. Additional chemical were plotted. Statistical significance of IRIF phenotypes was probes pointed to two pathways downstream of glycolysis, the determined by two-tailed, unpaired t test with Welch correc- hexosamine biosynthetic pathway (HBP) and tricarboxylic acid tion using GraphPad Prism 6 software. P values of 0.05 (TCA) cycle, mediating opposing effects on IRIF persistence, DSB are considered to be statistically significant [ÃÃÃ, P 0.001; repair, and cell senescence. Finally, we were able to implicate ÃÃ, P 0.01; Ã, P 0.05. P > 0.05 is not significant (n.s.)]. Polycomb Repressive Complex (PRC) 1 and 2 as the ultimate targets of cancer metabolic reprogramming in DSB repair. Taken RNAi gene silencing experiments together, these findings reveal critical connections between cancer Sets of three validated gene-specific Trilencer-27 siRNA cell metabolism, DSB repair, and senescence with implications for duplexes targeting expression of OGT and OGA (MGEA5) and genomic instability, carcinogenesis, and therapeutic resistance. the Trilencer-27 Universal scrambled negative control siRNA duplex were obtained from OriGene Technologies. Materials and Methods The siRNA sequences used in this study were: Cell lines and tissue culture OGT(a) - ACUACUCAGAUCAACAAUAAGGCTG; The MCF7 Tet-On Advanced cell line was obtained from OGT(b) - CCUACUCUAAUAUGGGAAACACUCT; Clontech. The generation and characterization of the OGT(c) - GGCACAUCGAGAAUAUCAGGCAGGA; MCF7GFP-IBD cell line has been described (20) and was used with MGEA5(a) - CCUCUAGAAUGGUAACAAAUCAGCC; further authentication by IDEXX BioResearch within the last MGEA5(b) - GCACGAGAAUAUGAGAUAGAGUUCA; 6 months. Panc 02GFP-IBD, U-87 MGGFP-IBD, and hTERT- MGEA5(c) - CGAGCAAAUAGUAGUGUUGUCAGTG. HME1GFP-IBD cell lines were developed similarly from parent