crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 18, pp. 9482–9491, April 29, 2016 Author’s Choice Published in the U.S.A. Crystal Structure and Activity Studies of the C11 Cysteine Peptidase from Parabacteroides merdae in the Human Gut Microbiome* Received for publication, November 27, 2015, and in revised form, February 4, 2016 Published, JBC Papers in Press, March 3, 2016, DOI 10.1074/jbc.M115.706143 Karen McLuskey‡1, X Jaspreet S. Grewal‡§1, Debanu Das¶ʈ, Adam Godzik¶ʈ**, Scott A. Lesley¶‡‡§§, Ashley M. Deacon¶ʈ, Graham H. Coombs¶¶, Marc-André Elsliger¶‡‡, Ian A. Wilson¶‡‡2, and X Jeremy C. Mottram‡§3 From the ‡Wellcome Trust Centre for Molecular Parasitology, Institute of Infection, Immunity and Inflammation, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8TA, United Kingdom, the §Department of Biology, Centre for Immunology and Infection, University of York, Wentworth Way, Heslington, York YO10 5DD, United Kingdom, the ¶Joint Center for Structural Genomics, the ʈStanford Synchrotron Radiation Lightsource, SLAC National Accelerator Laboratory, Menlo Park, California 94025, the ‡‡Department of Integrative Structural and Computational Biology, The Scripps Research Institute, La ʈ Jolla, California 92037, the Center for Research in Biological Systems, University of California, San Diego, La Jolla, California, Downloaded from 92093, the **Program on Bioinformatics and Systems Biology, Sanford Burnham Prebys Medical Discovery Institute, La Jolla, California 92037, the §§Protein Sciences Department, Genomics Institute of the Novartis Research Foundation, San Diego, California 92121, and the ¶¶Strathclyde Institute of Pharmacy and Biomedical Sciences, University of Strathclyde, Glasgow G4 0RE, United Kingdom http://www.jbc.org/ Clan CD cysteine peptidases, a structurally related group of Cysteine peptidases play crucial roles in the virulence of bac- peptidases that include mammalian caspases, exhibit a wide terial and other eukaryotic pathogens. In the MEROPS pepti- range of important functions, along with a variety of specificities dase database (1), clan CD contains groups (or families) of cys- and activation mechanisms. However, for the clostripain family teine peptidases that share some highly conserved structural (denoted C11), little is currently known. Here, we describe the elements (2). Clan CD families are typically described using the at UNIV OF STRATHCLYDE on September 18, 2017 first crystal structure of a C11 protein from the human gut bac- name of their archetypal, or founding, member and also given terium, Parabacteroides merdae (PmC11), determined to 1.7-Å an identification number preceded by a “C,” to denote cysteine resolution. PmC11 is a monomeric cysteine peptidase that com- peptidase. Although seven families (C14 is additionally split ␣ ␤ ␣ prises an extended caspase-like / / sandwich and an unusual into three subfamilies) have been described for this clan, crystal C-terminal domain. It shares core structural elements with clan structures have only been determined from four: legumain CD cysteine peptidases but otherwise structurally differs from (C13) (3), caspase (C14a) (4), paracaspase (C14b(P) (5), meta- the other families in the clan. These studies also revealed a well caspase (C14b(M) (6), gingipain (C25) (7), and the cysteine pep- ordered break in the polypeptide chain at Lys147, resulting in a tidase domain (CPD) of various toxins (C80) (8). No structural large conformational rearrangement close to the active site. Bio- information is available for clostripain (C11), separase (C50), or chemical and kinetic analysis revealed Lys147 to be an intramo- PrtH-peptidase (C85). lecular processing site at which cleavage is required for full acti- Clan CD enzymes have a highly conserved His/Cys catalytic vation of the enzyme, suggesting an autoinhibitory mechanism dyad and exhibit strict specificity for the P residue of their for self-preservation. PmC11 has an acidic binding pocket and a 1 substrates. However, despite these similarities, clan CD forms a preference for basic substrates, and accepts substrates with Arg and Lys in P1 and does not require Ca2؉ for activity. Collec- functionally diverse group of enzymes: the overall structural tively, these data provide insights into the mechanism and activ- diversity between (and at times within) the various families pro- ity of PmC11 and a detailed framework for studies on C11 pep- vides these peptidases with a wide variety of substrate specific- tidases from other phylogenetic kingdoms. ities and activation mechanisms. Several members are initially expressed as proenzymes, demonstrating self-inhibition prior * This work was supported by the Medical Research Council Grant to full activation (2). MR/K019384, Wellcome Trust Grants 091790 and 104111, and National The archetypal and arguably most notable family in the clan Institutes of Health Grant U54 GM094586 (JCSG). The SSRL Structural Molecular Biology Program is supported by the DOE Office of Biological is that of the mammalian caspases (C14a), although clan CD and Environmental Research and National Institutes of Health (NIH), members are distributed throughout the entire phylogenetic National Center for Research Resources, Biomedical Technology Program kingdom and are often required in fundamental biological pro- Grant P41RR001209, and the NIMGS. The content is solely the responsibil- ity of the authors and does not necessarily represent the official views of cesses (2). Interestingly, little is known about the structure or the NIGMS or NIH. The authors declare that they have no conflicts of inter- function of the C11 proteins, despite their widespread distribu- est with the contents of this article. tion (1) and its archetypal member, clostripain from Clostrid- Author’s Choice—Final version free via Creative Commons CC-BY license. The atomic coordinates and structure factors (code 3UWS) have been deposited ium histolyticum, first reported in the literature in 1938 (9). in the Protein Data Bank (http://wwpdb.org/). Clostripain has been described as an arginine-specific pepti- 1 Both authors contributed equally to this article. dase with a requirement for Ca2ϩ (10) and loss of an internal 2 To whom correspondence may be addressed. E-mail: [email protected]. 3 To whom correspondence may be addressed. E-mail: jeremy.mottram@ nonapeptide for full activation; lack of structural information york.ac.uk. on the family appears to have prohibited further investigation. 9482 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 291•NUMBER 18•APRIL 29, 2016 P. merdae C11 Cysteine Peptidase As part of an ongoing project to characterize commensal AAACTGCCTTATACCAGCCGAC; V-PIPE (forward): TAA- bacteria in the microbiome that inhabit the human gut, the CGCGACTTAATTAACTCGTTTAAACGGTCTCCAGC; and structure of C11 peptidase, PmC11, from Parabacteroides mer- V-PIPE (reverse): GCCCTGGAAGTACAGGTTTTCG- dae was determined using the Joint Center for Structural TGATGATGATGATGAT. Genomics (JCSG)4 HTP structural biology pipeline (11). The Protein Purification for Crystallization—Cells were resus- structure was analyzed, and the enzyme was biochemically pended, homogenized, and lysed by sonication in 40 mM Tris characterized to provide the first structure/function correla- (pH 8.0), 300 mM NaCl, 10 mM imidazole, and 1 mM Tris(2- tion for a C11 peptidase. carboxyethyl)phosphine hydrochloride (TCEP) (Lysis Buffer 1) ␮ ␮ Ϫ1 containing 0.4 mM MgSO4 and 1 l of 250 unit/ l of benzo- Experimental Procedures nase (Sigma). The cell lysate was then clarified by centrifugation Cloning, expression, purification, crystallization, and struc- (32,500 ϫ g for 25 min at 4 °C) before being passed over Ni2ϩ- ture determination of PmC11 were carried out using standard chelating resin equilibrated in Lysis Buffer 1 and washed in the JCSG protocols (11) as follows. same buffer supplemented with 40 mM imidazole and 10% (v/v) Cloning—Clones were generated using the polymerase glycerol. The protein was subsequently eluted in 20 mM Tris incomplete primer extension (PIPE) cloning method (12). The (pH 8.0), 150 mM NaCl, 10% (v/v) glycerol, 1 mM TCEP, and 300 gene encoding PmC11 (SP5111E) was amplified by polymerase mM imidazole, and the fractions containing the protein were Downloaded from chain reaction (PCR) from P. merdae genomic DNA using Pfu- pooled. Turbo DNA polymerase (Stratagene), using I-PIPE primers that To remove the His tag, PmC11 was exchanged into 20 mM included sequences for the predicted 5Ј and 3Ј ends (shown Tris (pH 8.0), 150 mM NaCl, 30 mM imidazole, and 1 mM TCEP below). The expression vector, pSpeedET, which encodes an using a PD-10 column (GE Healthcare), followed by incubation amino-terminal tobacco etch virus protease-cleavable expres- with 1 mg of His-tagged tobacco etch virus protease per 15 mg http://www.jbc.org/ sion and purification tag (MGSDKIHHHHHHENLYFQ/G), of protein for2hatroom temperature and subsequent over- was PCR amplified with V-PIPE (Vector) primers. V-PIPE and night incubation at 4 °C. The sample was centrifuged to remove I-PIPE PCR products were mixed to anneal the amplified DNA any precipitated material (13,000 ϫ g for 10 min at 4 °C) and the fragments together. Escherichia coli GeneHogs (Invitrogen) supernatant loaded onto Ni2ϩ-chelating resin equilibrated with competent cells were transformed with the I-PIPE/V-PIPE 20 mM Tris (pH 8.0), 150 mM NaCl, 30 mM imidazole, and 1 mM at UNIV OF STRATHCLYDE on September 18, 2017 mixture and dispensed on selective LB-agar plates. The cloning