doi:10.1507/endocrj.EJ17-0384 ORIGINAL Transducin β-like 1, X-linked and nuclear receptor co-repressor cooperatively augment the ligand- independent stimulation of TRH and TSHβ gene promoters by thyroid hormone receptors Tetsuya Takamizawa *, Tetsurou Satoh *, Tomoko Miyamoto, Yasuyo Nakajima, Takahiro Ishizuka, Takuya Tomaru, Satoshi Yoshino, Akiko Katano-Toki, Ayaka Nishikido, Santosh Sapkota, Takuya Watanabe, Takashi Okamura, Emi Ishida, Kazuhiko Horiguchi, Syunichi Matsumoto, Sumiyasu Ishii, Atsushi Ozawa, Nobuyuki Shibusawa, Shuichi Okada and Masanobu Yamada Division of Endocrinology and Metabolism, Department of Internal Medicine, Gunma University Graduate School of Medicine, Maebashi, Japan Abstract. Mutations in TBL1X, a component of the nuclear receptor co-repressor (N-CoR) and silencing mediator of retinoic acid and thyroid hormone receptor co-repressor complexes, have recently been implicated in isolated central hypothyroidism (CeH). However, the mechanisms by which TBL1X mutations affect negative feedback regulation in the hypothalamus- pituitary-thyroid axis remain unclear. N-CoR was previously reported to paradoxically enhance the ligand-independent stimulation of TRH and TSHβ gene promoters by thyroid hormone receptors (TR) in cell culture systems. We herein investigated whether TBL1X affects the unliganded TR-mediated stimulation of the promoter activities of genes negatively regulated by T3 in cooperation with N-CoR. In a hypothalamic neuronal cell line, the unliganded TR-mediated stimulation of the TRH gene promoter was significantly enhanced by co-transfected TBL1X, and the co-transfection of TBL1X with N-CoR further enhanced promoter activity. In contrast, the knockdown of endogenous Tbl1x using short interfering RNA significantly attenuated the N-CoR-mediated enhancement of promoter activity in the presence of unliganded TR. The co-transfection of N365Y or Y458C, TBL1X mutants identified in CeH patients, showed impaired co-activation with N-CoR for the ligand- independent stimulation of the TRH promoter by TR. In the absence of T3, similar or impaired enhancement of the TSHβ gene promoter by the wild type or TBL1X mutants, respectively, was observed in the presence of co-transfected TR and N- CoR in CV-1 cells. These results suggest that TBL1X is needed for the full activation of TRH and TSHβ gene promoters by unliganded TR. Mutations in TBL1X may cause CeH due to the impaired up-regulation of TRH and/or TSHβ gene transcription despite low T3 levels. Key words: Central hypothyroidism, Transducin β-like 1, X-linked, Co-repressor, TRH, TSHβ CENTRAL HYPOTHYROIDISM (CeH) is diagnosed conditions including pituitary and hypothalamic tumors, based on plasma free T4 levels less than the reference brain surgery and irradiation, granulomatous diseases, range in combination with inappropriately normal TSH vascular diseases, infection, and trauma as well as sev- levels [1]. Acquired CeH may be caused by a number of eral drugs such as glucocorticoids, dopamine, somato- statin analogs, and a retinoid X receptor agonist [1]. On Submitted Aug. 31, 2017; Accepted Apr. 20, 2018 as EJ17-0384 the other hand, isolated congenital CeH is known to be Released online in J-STAGE as advance publication May 23, 2018 caused by mutations in TSHβ, TRHR, and IGSF1 [1-3]. Correspondence to: Tetsurou Satoh, MD, PhD, Division of Endo- In a mouse model, we previously showed that the knock- crinology and Metabolism, Department of Internal Medicine, out of Trh resulted in isolated congenital CeH [4, 5]. Gunma University Graduate School of Medicine, 3-39-15 Showa- machi, Maebashi 371-8511, Japan. Missense mutations in transducin β-like 1, X-linked E-mail: [email protected] (TBL1X), which is located on human chromosome *These authors contributed equally to this manuscript. Xp22.3-22.2, were recently shown to cause isolated CeH ©The Japan Endocrine Society 2 Takamizawa et al. frequently complicated by hearing disturbances in Dutch mechanisms by which wild-type TBL1X and mutated patients [6]. TBL1X identified in CeH patients affect the ligand- TBL1X was identified as one of the core components independent stimulation of TRH and TSHβ gene promot- in nuclear receptor co-repressor (N-CoR)/silencing medi- ers by TR in cooperation with N-CoR. ator of retinoic acid and thyroid hormone receptors (SMRT) co-repressor complexes [7, 8]. In the absence of Materials and Methods T3, the co-repressor complexes associate with DNA- bound thyroid hormone receptors (TR) in order to Cell culture actively repress the transcription of positively regulated N-1, a mouse embryonic hypothalamic cell line genes by thyroid hormone (TH) through tightly packag- immortalized by the retroviral transfer of the SV40 large ing the surrounding chromatin structure via the deacety- T-antigen, was obtained from CELLutions BIOSYSTEMS lation of histone tails [9]. The human TBL1X protein, (Westbury, NY). CV-1 cells were kindly provided by Dr. consisting of 526 amino acids, belongs to the F-box/ Shigekazu Sasaki (Hamamatsu Medical University, WD40 domain protein family [6] and is expressed in Hamamatsu, Japan). These cells were cultured in DMEM several hypothalamic nuclei including the paraventricu- supplemented with 10% FBS (Biowest, Nuaillé, France) lar nucleus and pituitary gland [6]. TBL1X was previ- and ampicillin/streptomycin (GIBCO by Life Technology). ously reported to function as a specific adaptor that recruits the ubiquitin-conjugating/19S proteasome com- Plasmids plex, which mediates the exchange of co-repressors for Firefly luciferase reporter vectors driven by the mouse co-activators in vitro [10] and also interacts with the TRH gene promoter (–256/+83 pA3Luc), human TSHβ hypoacetylated histones H2 and H4 [8]. Two mutant gene promoter (–1,192/+38 pA3Luc), and Herpes TBL1X proteins, N365Y and H453Y identified in CeH Simplex virus thymidine kinase gene promoter patients were found to be poorly expressed when tran- (TK109-pA3Luc) were described previously [11, 13, 14]. siently transfected into culture cells, and this was sugges- Expression vectors for mouse TRα1 (pRSV-TRα1), ted to be due to aberrant protein folding or stability. human TRβ1 (pKCR2-TRβ1), mouse TRβ2 (pRSV- In addition, the Y458C mutant TBL1X protein was TRβ2), and mouse N-CoR (pCMX-FLAG-mN-CoR) expressed at a similar level to the wild-type protein in were described previously [11, 13, 15]. Expression vec- transient transfection, but showed reduced thermal stabil- tors for human TBL1X (pCMV6-Entry-TBL1X) were ity in vitro [6]. This biochemical characterization of obtained from OriGene Technologies (Rockville, MD). mutated TBL1X proteins identified in CeH patients sug- Plasmids expressing GATA2 (pcDNA2.1TOPO-GATA2) gests that the instability of mutant proteins is responsible and Pit-1 (pBKCMV-Pit-1) were described previously for impaired increases in serum TSH levels in these [14]. patients; however, the molecular mechanisms by which mutant TBL1X proteins functionally disturb the nega- Total RNA isolation and RT-PCR analysis tive feedback regulation of hypothalamic TRH and/or Total RNA was isolated from N-1 and CV-1 cells pituitary TSHβ gene transcription by TH have not yet using Isogen (NIPPON GENE, Tokyo, Japan) according been elucidated. to the manufacturer ’ s protocol. Five micrograms of Previous studies and our group demonstrated that the total RNA was subjected to first-strand cDNA synthesis promoter activities of the TRH and TSHβ genes were using Superscript III reverse transcriptase (Invitrogen). stimulated or repressed by co-transfected TR in the One microliter of cDNA was amplified by PCR using absence or presence of T3, respectively, using transient AmpliTaq DNA polymerase (Thermo Fisher transfection assays [11-13] and also that the co- SCIENTIFIC). The nucleotide sequences of the PCR transfection of N-CoR/SMRT paradoxically augmented primers used were as follows: Ncor sense GTCA the ligand-independent stimulation of TRH and TSHβ CAGCCCATTTGATCCT, Ncor antisense CCTGCATC gene promoters by TR [12, 13]. However, it currently TGCTGTGAGGTA; Tbl1x sense ATCAAGTGGAGT remains unclear whether core components other than N- CCCACAGG, Tbl1x antisense TCCACTGGCCAAA CoR/SMRT in co-repressor complexes affect the unli- TACTTCC; Glyceraldehyde-3-phosphate dehydrogenase ganded TR-mediated activation of TRH and TSHβ gene (GAPDH) sense ACCACAGTCCATGCCATCAC, anti- promoters. In the present study, we investigated the sense TCCACCACCCTGTTGCTGTA. All PCR primers Endocrine Journal Advance Publication Endocrine Journal Advance Publication Regulation of TRH and TSHβ promoters by TBL1X 3 were designed from different exons of each gene in order using pCMV6-entry-TBL1X as the template. The proper to avoid genomic DNA amplification. Predicted PCR introduction of mutations was verified by nucleotide product sizes were 243 base pairs (bp) for Ncor, 192 bp sequencing. for Tbl1x, and 462 bp for Gapdh. PCR was performed under the following conditions for 35 cycles: denaturing Preparation of whole cell lysates (WCL) and at 94°C for 30 sec, annealing at 56°C for 30 sec, and immunoblotting extension at 72°C for 1 min. PCR products were separa- N-1 cells were split onto 100-mm dishes and trans- ted by agarose gel electrophoresis and stained with ethi- fected with the wild-type or mutant TBL1X expression dium bromide. Proper amplification was verified by the vector using Lipofectamine 2000 reagent (Thermo Fisher direct sequencing of PCR products. SCIENTIFIC). Media were changed after 16 hours of transfection and WCL were prepared
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages9 Page
-
File Size-