Viruses 2015, 7, 1642-1650; doi:10.3390/v7041642 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Communication Presence of Poly(A) Tails at the 3'-Termini of Some mRNAs of a Double-Stranded RNA Virus, Southern Rice Black-Streaked Dwarf Virus Ming He 1, Ziqiong Jiang 2, Shuo Li 3,* and Peng He 1,* 1 State Key Laboratory Breeding Base of Green Pesticide and Agricultural Bioengineering, Key Laboratory of Green Pesticide and Agricultural Bioengineering, Ministry of Education, Guizhou University, Guiyang 550025, China; E-Mail: [email protected] 2 Plant Protection Station, Rural work office, Rongjiang County, Guizhou 557200, China; E-Mail: [email protected] 3 Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Jiangsu Technical Service Center of Diagnosis and Detection for Plant Virus Diseases, Nanjing 210014, China * Authors to whom correspondence should be addressed; E-Mails: [email protected] (S.L.); [email protected] (P.H.); Tel.: +86-025-8439-0394 (S.L.); +86-851-8829-2090 (P.H.). Academic Editor: Thomas Hohn Received: 21 February 2015 / Accepted: 23 March 2015 / Published: 31 March 2015 Abstract: Southern rice black-streaked dwarf virus (SRBSDV), a new member of the genus Fijivirus, is a double-stranded RNA virus known to lack poly(A) tails. We now showed that some of SRBSDV mRNAs were indeed polyadenylated at the 3' terminus in plant hosts, and investigated the nature of 3' poly(A) tails. The non-abundant presence of SRBSDV mRNAs bearing polyadenylate tails suggested that these viral RNA were subjected to polyadenylation-stimulated degradation. The discovery of poly(A) tails in different families of viruses implies potentially a wide occurrence of the polyadenylation-assisted RNA degradation in viruses. Keywords: Southern rice black-streaked dwarf virus; double-stranded RNA virus; poly(A) tails at mRNAs Viruses 2015, 7 1643 1. Introduction RNA of many eukaryotic viruses, ranging from DNA to RNA viruses, have 3' poly(A) tails [1], which are synthesized not only posttranscriptionally, but also by direct transcription from the poly(U) stretched template strand [2–5]. Regardless of synthesis mechanism used, the viral poly(A) tails have been considered to play crucial roles in RNA stability and translation, resembling roles of the stable poly(A) tails in eukaryotic mRNA [6,7]. Until recently, the function of poly(A) tails in destabilizing the viral RNA was revealed. The viral mRNA containing poly(A) or poly(A)-rich tails were detected in HeLa cells infected with Vaccinia virus (a double-stranded [ds] DNA virus) [8]. Furthermore, the polyadenylate tails were also found in Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Odontoglossum ring-spot virus (ORSV), Cucumber green mottle mosaic virus (CGMMV), Tobacco rattle virus (TRV), Turnip crinkle virus (TCV) and Tobacco necrosis virus (TNV) [9], seven positive-strand RNA viruses known to lack poly(A) tails and terminate 3'-termini with tRNA-like structure (TLS) or non-TLS heteropolymeric sequence [6]. The presence of poly(A) tails suggests that these viral RNAs are subjected to poly(A)-stimulated degradation. In this paper, the poly(A) and poly(A)-rich tails were first reported at the 3'-termini of the mRNAs of a dsRNA virus, Southern rice black-streaked dwarf virus (SRBSDV), generally recognized to lack poly(A) tails. SRBSDV has been proposed as a new member in the genus Fijivirus of the family Reoviridae [10], which causes a serious rice disease in South China and Vietnam in recent years [11,12]. SRBSDV is most closely related to but distinct from Rice black-streaked dwarf virus (RBSDV), which is also a member of the Fijivirus genus [10,13]. SRBSDV genome contains 10 segments, named as S1-S10 in the descending order of molecular weight. Comparison of 10 genomic segments of SRBSDV with their counterparts in RBSDV suggests that SRBSDV encodes 13 open reading frames (ORFs) and possesses 6 putative structural proteins (P1, P2, P3, P4, P8, and P10) and 7 putative nonstructural proteins (P5-1, P5-2, P6, P7-1, P7-2, P9-1 and P9-2) [13]. At present, the functions of partial genes have been studied. The P6, encoded by S6, has been identified as an RNA silencing suppressor [14]. P7-1 induces the formation of tubules as vehicles for rapid spread of virions through basal lamina from midgut epithelium in its vector, the white-backed planthopper [15]. P9-1 is essential for viroplasm formation and viral replication in non-host insect cells and vector insects [16]. However, no reports are available to date to assign functions to the proteins encoded by other ORFs. The putative function of these proteins can only be postulated based on their RBSDV homologs. P1, P2, P3 and P4 are putative RNA-dependent RNA polymerase (RdRp), core protein, capping enzyme and outer-shell B-spike protein, respectively [13,17]. P8 and P10 are putative core and major outer capsid proteins, respectively [13,18]. SRBSDV mRNAs were considered to lack of poly(A) tails at the 3'-ends. However, in previous experiments, all 13 ORFs of the 10 RNA segments could be amplified via RT-PCR using oligo(dT)18 to prime cDNA synthesis as templates [19], suggesting that each SRBSDV mRNA might bear a potential poly(A) tail at the 3' terminus. In this paper, we confirmed that some of SRBSDV mRNAs were indeed polyadenylated at the 3' terminus in plant hosts. Viruses 2015, 7 1644 2. Materials and Methods 2.1 Virus and RNA Extraction SRBSDV isolate used in the experiment was obtained from rice and maize plants showing typical dwarf symptoms with white waxy galls in 2014 in 8 counties of 4 provinces in China, including Yunnan, Guizhou, Hunan, and Jiangxi provinces. Total RNA from infected rice and maize leaf and stem tissue were extracted following the standard protocol of TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The isolate was identified as SRBSDV excluding RBSDV by reverse transcription RT-PCR using specific primers for distinguishing the two viruses [20]. 2.2 Rapid Amplification of cDNA End (RACE) PCR To confirm characterization of the polyadenylate tails associated with viral mRNAs, the 3' Rapid Amplification of cDNA End (RACE) PCR was performed using BD SMART™ RACE cDNA Amplification Kit (TaKaRa, Dalian, Liaoning, China). In this case, reverse transcription reactions were performed using total RNA (respectively from infected rice and maize) as templates and adapter-oligo(dT) primer (P1) (Table 1) to prime first cDNA strand synthesis. 10 specific upstream primers and 10 nested primers respectively corresponding to SRBSDV each mRNA were designed according to China isolate HuNyy sequence information (GenBank No. JQ034348-JQ034357) (Table 1). Each of upstream primers was paired with adapter primer P2 (as downstream primer) for the 1st PCR amplification using PrimeSTAR HS DNA polymerase (TaKaRa) and cDNA as template. The PCR products from the 1st PCR reaction were subjected to a subsequent the 2nd PCR run with nested primers and adapter primer P3 (Figure 1A). The amplified products were analyzed by 1.5% agarose gel electrophoresis, and the resulting bands, in agreement with the predicted sizes, were individually cloned into pGEM-T Easy vector (Promega, Madison, USA) and subjected to sequence analysis. Approximately 5–10 clones from each isolate were randomly selected and sequenced. Table 1. PCR primers used in the experiment. Reference Primer Sequence (5'→3') Target GenBank No. S1-F TCAGTGCTCAAGGCTCACAAGATTGAAG S1-mRNA JQ034348 S1-nested-F ATTCATGAACTTAATGGGCGCAGAGTG S2-F CGGCACATCTTCACCCGCAGACTTC S2-mRNA JQ034349 S2-nested-F CTGATGAATTGCTCGACCGTTACATTAG S3-F GATGGGATTAGCGAAATTGCATTTGGAG S3-mRNA JQ034350 S3-nested-F TGCATGGACATTCATTTTCAGATCAAG S4-F TAGATTTTGTTATTCCCGGTGTTCGAGAAG S4-mRNA JQ034351 S4-nested-F AGTGCGGATGTGGCTGCAGATAAATTC S5-F TGTGATCAGTGCCATGTCCACTAGCATC S5-mRNA JQ034352 S5-nested-F AATCATCCCTGTGCGCTTCGACTTAG S6-F CGATACTCTGATGAAACAGGCGAAGCTC S6-mRNA JQ034353 S6-nested-F TGAGAACCAATGGAGCGCGTATGGA S7-F ACTACTTCAGCTGAAGATGTCGACGCAC S7-mRNA JQ034354 Viruses 2015, 7 1645 Table 1. Cont. Reference Primer Sequence (5'→3') Target GenBank No. S7-nested-F TTGGCAAGCGATGGAAAGAAGATGG S8-F CGTATTGGACGATGAGCGCAACTTTG S8-mRNA JQ034355 S8-nested-F TGAATTAGCGTTCGTACCTCATTCGCTG S9-F TTGGACTTGGCTAACTACGTTCGACAAC S9-mRNA JQ034356 S9-nested-F GGAATTGGATGATCGAGTTGAAAAATTGG S10-F CTCCCTGCATCGATTACATCAAACTTGG S10-mRNA JQ034357 S10-nested-F GCCAACAATTTATTGAAGGCGGATCG S10-NVP TTCCATCTCTATCATTCAGTCAAG S10-mRNA GCTGTCAACGATACGCTACGTAAC Adapter-oligo(dT) (P1) Poly(A) tails GGCATGACAGTG(T)18VN Adapter primer P2 GCTGTCAACGATACGCTACGTAACG Adapter Adapter primer P3 CGCTACGTAACGGCATGACAGTG Adapter 3. Results and Discussion After 3' RACE, the 3'-termini sequences of viral mRNAs were obtained, and the results indicated that SRBSDV mRNAs indeed possessed ploy(A) or poly(A)-rich tails in plant hosts. Taking S10-mRNA as an example to analyze the nature of poly(A) and poly(A)-rich tails, a total of 42 polyadenylated viral mRNA molecules were cloned from rice and maize plants. In addition to 10 mRNAs bearing poly(A) tails exclusively comprised of adenosines, a large number of mRNAs possessed poly(A)-rich tails (Figure 1B). Notably, the heterogeneity of these poly(A)-rich tails was confined to their 5' ends, and they all terminated in homogenous adenosines (17–23 nt) (Figure 1B), which was possibly due to the 3' bias of oligo(dT)-dependent reverse transcription. Most poly(A)-rich tails were not at the downstream of S10-mRNA entire 3' untranslated region (UTR), and replaced partial 3' UTR sequences. For example, the tail of isolate LX-1 replaced 3' UTR sequence of S10-mRNA from the nucleotide 1753 (Figure 1B). In some poly(A)-rich tails (isolate JH-1, LX-1, PT-1, PT-5, YJ-1 and YJ-4), there were more non-viral nucleotides (35–208 nt) preceded polyadenylates, which was considered to originate from host plants. In order to further certify the presence of poly(A) tails and exclude non-specificity of reverse transcription reaction, these non-viral nucleotides was used to design downstream primers (e.g., S10-NVP) to perform PCR with upstream primer from S10 (Figure 1A), and the result of amplification was positive (data no shown), indicating sufficiently the existence of mRNA bearing ployadenylate tails.