
US 20170051296A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0051296A1 BEETHAM et al. (43) Pub. Date: Feb. 23, 2017 (54) METHODS AND COMPOSITIONS FOR (60) Provisional application No. 61/953,333, filed on Mar. INCREASING EFFICIENCY OF TARGETED 14, 2014, provisional application No. 62/051,579, GENE MODIFICATION USING filed on Sep. 17, 2014, provisional application No. OLGONUCLEOTDE-MEDIATED GENE 62/075,811, filed on Nov. 5, 2014, provisional appli REPAIR cation No. 62/075,816, filed on Nov. 5, 2014, provi sional application No. 62/133,129, filed on Mar. 13, (71) Applicants: CIBUS US LLC, San Diego, CA (US); 2015, provisional application No. 61/801,333, filed CIBUS EUROPE B.V., AD Kapelle on Mar. 15, 2013. (NL) (72) Inventors: Peter R. BEETHAM, Carlsbad, CA Publication Classification (US); Gregory F.W. GOCAL, San (51) Int. C. Diego, CA (US); Christian CI2N 5/82 SCHOPKE, Carlsbad, CA (US); Noel (2006.01) SAUER, Oceanside, CA (US); James (52) U.S. C. PEARCE, La Jolla, CA (US); Rosa E. CPC ....... CI2N 15/8213 (2013.01); C12N 2800/80 SEGAMI, Escondio, CA (US); Jerry (2013.01) MOZORUK, Encinitas, CA (US) (57) ABSTRACT (21) Appl. No.: 15/069.885 Provided herein include methods and compositions for (22) Filed: Mar. 14, 2016 effecting a targeted genetic change in DNA in a cell. Certain aspects and embodiments relate to improving the efficiency Related U.S. Application Data of the targeting of modifications to specific locations in (63) Continuation-in-part of application No. PCT/ genomic or other nucleotide sequences. As described herein, US2015/020622, filed on Mar. 14, 2015, Continu nucleic acids which direct specific changes to the genome ation-in-part of application No. 14/777.357, filed on may be combined with various approaches to enhance the Sep. 15, 2015, filed as application No. PCT/US2014/ availability of components of the natural repair systems 029566 on Mar. 14, 2014. present in the cells being targeted for modification. Patent Application Publication Feb. 23, 2017. Sheet 1 of 43 US 2017/0051296 A1 Spsodooid bui3Sejon, ueeJS X Patent Application Publication Feb. 23, 2017 Sheet 2 of 43 US 2017/0051296 A1 A. Okazaki Fragment Riis (BP8 f : C fifts' 2" - {} GG A CGA GG GG GCC AG, G (7 Baer BFPO/NC: UCA. G. GG UCGG GGT AGC G GC TGA AGC ACT GCA CGC CGT GGG TGA AGG GG CA CGA. GGG G 68 AGG G 7 ser BFP4/C: G CLG CCC GUGCCC FGG CCC A CC (TC GTG ACC ACC TFC ACC EAC GGC GTG CA, GC A&C CGC AC CCC (f -er) 2 - 0- ie group or first 5 RNA base (RNA bases without the 2" - O - Me groups are in boxes) 8. Okazaki fragent. Riis BF4 or f. Or NCAF fis' 2 - Me (9) AG C AG CC AC C. (f -ie) BFPOfC: G CUG CCC GUGCC. TGG CCC A CC CTC GTG ACC ACC TTC ACC CAC GGC GT3 CAG FGC FC AGC CGCTAC CCC G (7 mer) RNA bases 2 - 0 - 4a group on a of the RNA bases except for the base closest to the first hi? base of the GR38 (RNA base without the 3' - 0 - Me groups are in boxes) FG.2 Patent Application Publication Feb. 23, 2017 Sheet 3 of 43 US 2017/0051296 A1 BFP gene 5 CCiCACCCACGGCGGCAGGCCAGCCGCACCCCgaccacatgåAGCAGCACGAC 3' 3. GGAAGTGGGTGCCGCACGTCACGAAGTCGGCGATGd GGTGTACTTCGTCGTGCTG 5' Coye Sior Site 8 C hobbie bases (wt sequence) FG.3 Patent Application Publication Feb. 23, 2017 Sheet 4 of 43 US 2017/0051296 A1 &S 8 r S. g cra 35 8 r S. i; i gy n 1. ka g- as i. is S c- is A. isS. S. st N O a- ........ r ... S. E. as EX XXX Sca s Rxst GS-3 S. 3. ass policiefXNXXNXXYX. Se Se 35 s 5. is N 3 3. XX s is TOX, s i 1. thexx N-N-S x . as . gs ---- 3d c c c 1. rt r &n s- ce - Patent Application Publication Feb. 23, 2017. Sheet 5 of 43 US 2017/0051296 A1 0.25 0. 2 0.15 14 2. CRBFP C/60-mer C/01-mer C/201-mer C/60-fner CfOurner C/20-met W 3PS 3PS SPS SPS 3PS 3PS Only Only Only F.G. 5 Patent Application Publication Feb. 23, 2017. Sheet 6 of 43 US 2017/0051296 A1 Feb. 23, 2017. Sheet 7 of 43 US 2017/0051296 A1 004},?NG06[57]dqYNG?q Patent Application Publication Feb. 23, 2017. Sheet 8 of 43 US 2017/0051296 A1 ? Ç||| SeO &A:Sod d48 go abouaoied Patent Application Publication Feb. 23, 2017 Sheet 9 of 43 US 2017/0051296 A1 N T. is is N is it him N 's III. S-8 &S S& & SS SS S-8 &S NS s g g s g c gre vers worn c C. C. C P SeO e^i}Sod do go efouao jed Patent Application Publication Feb. 23, 2017. Sheet 10 of 43 US 2017/0051296A1 is EX. i; A. s Ex s e s 7 C. c. C. c. if x - ca. Patent Application Publication US 2017/0051296 A1 Patent Application Publication Feb. 23, 2017. Sheet 12 of 43 US 2017/0051296A1 c . - ? e at n) - - Se ... -- st als e- w N o: d c C C S90 8A:Sod dd) go efoueojed Patent Application Publication Feb. 23, 2017. Sheet 13 of 43 US 2017/0051296A1 i. n . is C & as S. C. S. &. e erra cy 2 S. () E a s is N as a ro to spw1 & O is- S& i.- A. s8 area a n s: as as geare &co is S.- . C 8x ko res. C & & -er ra d sers -- e. wo to c c c: C C C is C. S80 3A}}sod die Jo 86Due3.8d Patent Application Publication Feb. 23, 2017. Sheet 14 of 43 US 2017/0051296 A1 Siao. 3A Sod d46 go afouaoied Patent Application Publication Feb. 23, 2017. Sheet 15 of 43 US 2017/0051296A1 retent inne * CROK AE8 Conson % indels Protoplats" 24 Yes Yes 0.087 2.80 Microcalit 3 Yes 84. * denotes time after PEG delivery of TALEN plasmids and GRONS. * denotes protoplasts and micromalii are not from the same experiment. FG. 4 retreit ** fire * CRISPR % indeis icrocai 3. Yes 46.5 icrocai * Fine after PEG delivery of CRISPR piasmids * Treatments are not from the same experiment, F.G. 5 Patent Application Publication Feb. 23, 2017. Sheet 16 of 43 US 2017/0051296A1 (O so ro ill ce - ' (p & S S S S 3 s c Seo bui3Sejon d8 go ueojed soon ill & C. x- n rary g N w- wer Sepu Do go efoueojed Patent Application Publication Feb. 23, 2017. Sheet 17 of 43 US 2017/0051296A1 0.07 0.25 3 0.06 3. 3.2 CG8 ;as: 0.05 s w CGS 0.04 0.15 O.O. 0. is 0.02 0.0 0.05 CC2 CG SC-2 GRON only FS GRON FG 7A FG. 7B 4 e g 0.5 3 2 - g CG3 as O,4 CG4 8. f s .8 - ww. O3 - 0.6 5 04. 02 0.2. 0. *X: X X. O ------ CGS CGC CGS 3C-3 GRON only plus GRON FG. C FG. 7) Patent Application Publication Feb. 23, 2017. Sheet 18 of 43 US 2017/0051296A1 OO too O li. S <g OO k escoes s g CD Li ( 0 - Sepu Oo go efDueojed Patent Application Publication Feb. 23, 2017. Sheet 19 of 43 US 2017/0051296A1 wa. wo c (N K g g c Spoel OO go abdueojed Y O+ 3. gS & s s d s c s {d wr- ws- rary n s n- wer as stepui po so efoue3Jed Patent Application Publication Feb. 23, 2017. Sheet 20 of 43 US 2017/0051296A1 0.2O Zeocin Fhieomycin O, 8 ... 8 S. , 4. O, 2. ... O 0.08 O,08 0.04 O2 O.O 250 (OO O 250 1000 Antibiotic ug/ml. FG. 9 Patent Application Publication Feb. 23, 2017. Sheet 21 of 43 US 2017/0051296A1 G. 20 Patent Application Publication Feb. 23, 2017. Sheet 22 of 43 US 2017/0051296 A1 <---------- ar p?o?posWN86 Patent Application Publication Feb. 23, 2017. Sheet 23 of 43 US 2017/0051296A1 BFP CRISPR and Talen target region awa *w - as *W was 5'-CCACCCCGIGACCACCCACCCACCCGGCAGGCCACCCACCCCGACCACAGAAGCAGCACSACC, CA-3' 3- CGACCACCCACCCA 3C-2 (ACCACASACACACGAC 8-3 CCCCCCCAGCCACCC AEN 5'-CCACCCCGTGACCACCCACCCACGGCSGCACGC CASCCSCTACCCCCACCACAEGAAGC-3' 3- fit 87- Right FG.22A EPSPS TALEN target region 97, POA ^ ESS ORF 5'-ggagatgctggao--- j97agctatgcgt.cgctgocagctgctgtoacgccgctagoggcaactegoggi P10. ----- tic-3' - ef E-1 Right FG.22B Patent Application Publication Feb. 23, 2017. Sheet 24 of 43 US 2017/0051296A1 AMY310767 - Alopecurus myosuroides pastida ACCase translated protein (SEC, E0: MGSPG FiASPSS RINSAAA AFESSSFSRS SKKKSRR, KS S 8:00GSP PAGSSR (GAGDP KEGASAP SGSEKA } SYNG&E SEGRHASLS X;YEFCEG GKHSV y Ahi AAAKF 5 M&SWRWA; FGSEKAIC AMA EDMR NAEIRA (FERGGR 20. NNYAay. EAERTGVS AVWPG-GAS ENPEPCA. AKGFGP 28 ASSINAGK WGSAAAA GPASGS HELEC SIPEEMYRK 30 ACADEA, ASCO-IGYA M KAS.GGGG KGIRKNND EVKAFKQy 38 GEWPGSPIF MRLASQSRH EVOCEYG NiAAHSRC SCRRHQK 40 EEGPWAPR EKEEQAA RRAKAVGY; GAAVEY.YS METGEYYFE 43. NPR WEP ESAEN PAAQiaGMG IPPER RFYGYNGGG 50 YORKAA. APFNFE SOPKGCA VRSENPD GFKPGGKK 55. ESFKSKN; WGYFSVKSGG GEFASF GFAYGER SAATSMSA 60 KEIRGE - YVO NAPDFRE i GTR A&R (AERP 68. YS, GGA. YKii-AE WSEYVSY IK GOppKHIS WHSISNE 70 ESKYIR SGGSYR.R. GSEANYC CGGL8 GNSHIYA 75 EEEAGGR GKC & EPSR: AE PCK RF ABAyADy 80 PYAEVEVMKM CMP. SPAAG WINSEG AMAGIAR } }}SAK 85 RAEPFEGSF EMSL AASG HKRCAAS NAARMAGY HAAK () 90 CFA PFLQEEMS WAR PRR, KSEEGKYNE YKNK 95 KP-RE EACS KEER.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages196 Page
-
File Size-