Published online 20 August 2008 Nucleic Acids Research, 2008, Vol. 36, No. 16 5417–5425 doi:10.1093/nar/gkn528 DNA base flipping by both members of the PspGI restriction–modification system Michael A. Carpenter and Ashok S. Bhagwat* Department of Chemistry, Wayne State University, 5101 Cass Avenue, Detroit, MI 48202, USA Received May 1, 2008; Revised July 29, 2008; Accepted August 2, 2008 ABSTRACT sequence (1). The methyltransferase (MTase), M.PspGI, is believed to methylate the N4 position of cytosine. This The PspGI restriction–modification system recog- conclusion is based in part on sequence analysis that shows nizes the sequence CCWGG. R.PspGI cuts DNA that M.PspGI is highly similar to M.MvaI, a known N4- before the first C in the cognate sequence and cytosine methyltransferase and contains the SPPY M.PspGI is thought to methylate N4 of one of the sequence motif which is unique to the N4-cytosine methyl- cytosines in the sequence. M.PspGI enhances fluo- transferases (1–4). Additionally, it has been argued that if rescence of 2-aminopurine in DNA if it replaces the hyperthermophiles are to methylate cytosines in their second C in the sequence, while R.PspGI enhances DNA to protect it from endogenous restriction endonu- fluorescence when the fluorophore replaces ade- cleases, then they are likely to methylate the exocyclic nine in the central base pair. This strongly suggests nitrogen rather than carbon-5. This is because 5-methylcy- that the methyltransferase flips the second C in the tosine (5mC) has a high potential for deaminating to thy- recognition sequence, while the endonuclease flips mine causing C to T mutations (5). N4-methylcytosine both bases in the central base pair out of the duplex. does not present such a mutagenic hazard. It is not M.PspGI is the first N4-cytosine MTase for which known whether M.PspGI methylates the first or the second cytosine in its recognition sequence, but R.PspGI biochemical evidence for base flipping has been is inhibited by methylation of the inner cytosine on carbon- presented. It is also the first type IIP methyltransfer- 5byEscherichia coli Dcm (1) suggesting that this cytosine ase whose catalytic activity is strongly stimulated by may also be the site of methylation by M.PspGI. Together divalent metal ions. However, divalent metal ions these data suggest that M.PspGI methylates the second are not required for its base-flipping activity. In con- cytosine in its recognition sequence at the N4 position. trast, these ions are required for both base flip- R.PspGI is thought to flip both bases in the central base ping and catalysis by the endonuclease. The two pair of its recognition sequence out of the double helix. enzymes have similar temperature profiles for base We originally suggested this based largely on genetic evi- flipping and optimal flipping occurs at temperatures dence (6). We found that R.PspGI protects its cognate substantially below the growth temperature of the sequence, CCWGG, against deamination of cytosines to source organism for PspGI and for the catalytic uracil at high temperatures under conditions where the activity of endonuclease. We discuss the implica- enzyme bound to DNA without cutting (6). In contrast, tions of these results for DNA binding by these the enzyme or its catalytically inactive mutant, D138A, enzymes and their evolutionary origin. increased the rate of deamination of the third C in the sequence CCCGG by a factor of 14. We interpreted these data to mean that flipping of this base out of the duplex makes it more susceptible to hydrolytic attack. INTRODUCTION Subsequently, the structure of a related enzyme, PspGI restriction–modification (R–M) enzymes are two of R.Ecl18kI, which recognizes CCNGG showed that it the most heat stable R–M enzymes to have been described. flips both the bases in its central base pair (7), and The PspGI R–M system was found in Pyrococcus species strengthening the argument that R.PspGI does the same. strain GI-H, which has an optimal growth temperature of More recently, a preliminary report based on 2-aminopur- 858C and the PspGI endonuclease (R.PspGI) has a half life ine (2AP) fluorescence enhancement also suggested that of 2 h at 958C (1). The PspGI R–M enzymes recognize the R.PspGI flips its central bases out of the duplex (8). sequence CCWGG where W is A or T. The endonuclease It is generally believed that base flipping is the mecha- (REase), R.PspGI, is an isoschizomer of EcoRII that nism by which a DNA methyltransferase is able to cleaves DNA before the first cytosine in its recognition gain access to bases to perform chemistry. M.HhaI, a *To whom correspondence should be addressed. Tel: +313 577 2547; Fax: +313 577 8822; Email: [email protected] ß 2008 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. 5418 Nucleic Acids Research, 2008, Vol. 36, No. 16 C5-cytosine MTase, was the first MTase crystallized with Expression and purification of proteins its substrate DNA and the co-crystal showed that the Purification of wild-type (WT) PspGI and its D138A target base was flipped out of the duplex into the active mutant has been described previously (1,3). The expres- site of the enzyme (9). Subsequently, two other DNA sion constructs for these proteins, pET21a-PspGI-WT, methyltransferases, M.HaeIII, also a 5-cytosine MTase, pET21a-PspGI-D138A and pACYC-M.PspGI, were a and M.TaqI, an N6-adenine MTase, were also crystallized generous gift from Vera Pingoud (Justus-Liebig- in the presence of DNA and were found to flip the target Universita¨t, Giessen, Germany). These plasmids were base out of the double helix (10,11). introduced in the strain ER2744 (fhuA2 glnV44 e14À In addition to crystallography, fluorescence enhance- rfbD1? relA1? spoT1? endA1 thi-1 D(mcrC-mrr)114::IS10 ment of 2AP has been used to study base flipping by a lacZ::T7gene1) and expression of both endonuclease and number of MTases. This method takes advantage of the methyltransferase was induced with 300 mM IPTG and fol- fact that 2AP fluorescence quantum yield increases when lowed by incubation for 16 h at 168C. Cells were collected its environment becomes more polar (12). MTases that by centrifugation at 3000 g, resuspended in 50 ml lysis enhance 2AP’s fluorescence when the fluorophore replaces buffer (50 mM NaCl, 20 mM Tris–HCl pH 8.5) containing the base that is normally methylated include M.EcoRI (13), Complete EDTA-free Protease Inhibitor Cocktail from M.TaqI (14), M.HhaI (14), M.EcoP151 (15), M.EcoKI Roche Diagnostics (Indianapolis, IN, USA). The cells (16), M.RsrI (17), T4 Dam (18), M.KpnI (19) and E. coli were broken by sonication and the resulting lysate Dam (20). However, some exceptions to this general rule was centrifuged at 20 000 g for 30 min to remove cell also exist. This includes M.EcoRV, which did not enhance debris. The supernatant was then heated to 708C for 2AP fluorescence when it substituted the target base for 30 min and then centrifuged for 30 min at 20 000 g to methylation (21). Additionally, MTases M.EcoKI (16), remove the precipitated material. The cleared lysate was M.EcoRV (21) and M.EcoP151 (15) enhanced 2APs fluo- then loaded onto a P11 cellulose phosphate column rescence when it was placed at positions other than the base (Whatman, Maidstone, England) equilibrated with the to which the methyl group is transferred. lysis buffer. The column was washed with 3.5 column So far, all the MTases for which direct evidence volumes lysis buffer, followed by 3.5 column volumes of has been presented for base flipping have been either R.PspGI elution buffer (300 mM NaCl, 20 mM Tris pH C5-cytosine or N6-adenine methyltransferases. Only one 8.5). Subsequently, the M.PspGI was eluted from the N4-cytosine MTase has been crystallized to date, M.PvuII same column with 1 M NaCl in Tris pH 8.5. Proteins (22), but crystal structure of M.PvuII was obtained with- were concentrated in Millipore spin concentrators with out a DNA substrate. To obtain more direct evidence for MW cutoffs of 10 kDa and dialyzed against storage base flipping by the N4-cytosine MTases, we studied the buffer (10 mM Tris pH 7.9, 50 mM KCl, 0.1 mM EDTA, ability of M.PspGI to flip 2AP out of DNA and compared 1 mM DTT and 50% glycerol). Protein concentrations it to the ability of R.PspGI to do the same. The results were determined by using the Protein Assay kit from show that while both the enzymes in this R–M system flip Bio-Rad (Hercules, CA, USA). DNA bases, there are significant differences between their targets and flipping mechanism. Table 1. DNA oligomers MATERIALS AND METHODS Name Sequencea Melting temperature of duplexb (8C) Materials 0 0 REase MTase 2-Aminopurine-2 -deoxyribose-5 -triphosphate was pur- bufferc bufferd chased from TriLink BioTechnologies (San Diego, CA, USA), while 2AP free base was obtained from Sigma- 2AP18 TGCTACC2GGC Aldrich (St Louis, MO, USA). S-adenosyl-L-methionine GAAGATA-biotin 67 – O15N CTTCGCCTGGTAGCA – – (SAM) was obtained from New England Biolabs 2AP21 CGACGCAAGCCGACGCCA (Ipswich, MA, USA) and S-adenosyl-L-homocysteine GC2CCACCAGGACGCCGCATA 87 75 (SAH) was obtained from Sigma-Aldrich (St Louis, MO, 2AP26 CGACGCAAGCCGACGCCAGCAC USA). 2AP-containing DNA oligomers were synthesized CAC2AGGACGCCGCATA 85 71 2AP27 CGACGCAAGCCGACGCC by the W.M.