
Durak_Fig_S1 a b AnkG AnkG Control shRNA 1 shRNA 2 AnkG mRNA Expression AnkG 1.5 Control Actin AnkG shRNA1 AnkG shRNA2 ** 1.5 ** ** * 1.0 1.0 0.5 Fold Change 0.5 (Normliazed to Control) 0.0 0.0 Control AnkG AnkG 24 hr post-transfection 36 hr post-transfection 48 hr post-transfection shRNA1 shRNA2 c β−catenin mRNA Expression 1.5 1.0 0.5 Fold Change (Normliazed to Control) 0.0 Control AnkG AnkG shRNA1 shRNA2 Supplementary Figure 1: Ankyrin-G shRNAs specifically knocks-down ankyrin-G protein and mRNA levels, and does not change β-catenin mRNA levels. a) Ankyrin-G shRNAs significantly lowered ankyrin-G protein expression compared to control shRNA in P19 cell line assessed by Western blotting (Control and shRNA2, n=4; shRNA1, n=3). b) Ankyrin-G shRNAs significantly lowered ankyrin-G mRNA levels compared to control shRNA 48 hours after transfection in P19 cell line assessed by qPCR analysis. (Control and shRNA1, n=10; shRNA2, n=9). c) β-catenin mRNA levels were not changed after ankyrin-G knockdown, consistent with β-catenin protein levels (Control and shRNA1, n=7; shRNA2, n=6). All analyses, one-way analysis of variance (one-way ANOVA) followed by Dunnett’s Multiple Comparison Test, except panel (d) where Unpaired t-test is used; *, P<0.05; **, P<0.01; ***, P<0.001 1 Durak_Fig_S2 abc Control AnkG shRNA 24 hr BrdU Incorporation Cell Cycle Exit IZ IZ 15 * 100 * * * 10 80 5 60 BrdU+ GFP+ VZ VZ % BrdU+GFP+/GFP+ 40 0 % BrdU+ Ki67- GFP+/ Control AnkG AnkG Control AnkG AnkG shRNA 1 shRNA 2 shRNA1 shRNA2 GFP / BrdU / Ki67 GFP / BrdU / Ki67 Supplementary Figure 2: Ankyrin-G knockdown reduces neural progenitor proliferation in developing cortex a) Images of E16 mouse cortices electroporated at E13 with non- targeting (left panel, Control) and ankyrin-G-directed small hairpin (right panel, AnkG shRNA) and GFP expression plasmid. Images were stained for GFP (green), BrdU (red) and Ki67 (blue). Arrows indicate BrdU, GFP double-positive cells, and arrowheads indicate Ki67, BrdU, GFP triple positive cells. b) Ankyrin-G knockdown resulted in increased BrdU incorporation (Control, n=4; shRNA1 and shRNA2, n=7). c) Ankyrin-G knockdown decreased cell cycle exit (Control, n=3; shRNA1, n=8 and shRNA2, n=4). All analyses, one-way analysis of variance (one-way ANOVA) followed by Dunnett’s Multiple Comparison Test; *, P<0.05; **, P<0.01; ***, P<0.001 1 Supplemental Table 1: DNA construct and primer sequences Gene expression analysis. Gene-specific Forward sequence (5’-3’) Reverse sequence (5’-3’) primers ANK3 AGTGAAGAGCCAAAGGAGAAG TCAGAATCAAACTCCCTCGTG Ctnnb1 GCTATTCCACGACTAGTTCAGC AGCTCCAGTACACCCTTCTAC Actb AGCCATGTACGTAGCCATCC CTCTCAGCTGTGGTGGTGAA Knockdown assays. Gene-specific shRNA Ankyrin-G CCTGCTCATAGGAAGAGGAAA shRNA1 Ankyrin-G CCGCCTGGTAAAGAGACATAA shRNA2 ANK3, ankyrin-G (NM_170730.1); Ctnnb1, β-catenin (NM_007614); Actb, β-actin (NM_007393). Ankyrin-G shRNA1 (TRCN0000090056); ankyrin-G shRNA2 (TRCN0000090054). .
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages5 Page
-
File Size-