31 Calmodulin and calmodulin-dependent protein kinase II inhibit hormone secretion in human parathyroid adenoma Ming Lu1,2,3, Erik Berglund1, Catharina Larsson1,3, Anders Ho¨o¨g4, Lars-Ove Farnebo1 and Robert Bra¨nstro¨m1 1Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital L1:03, SE-171 76 Stockholm, Sweden 2Department of Geriatric Endocrinology, First Affiliated Hospital of Guangxi Medical University, NanNing, People’s Republic of China 3Center for Molecular Medicine (CMM), Karolinska University Hospital, SE-171 76 Stockholm, Sweden 4Department of Oncology–Pathology, Karolinska Institutet, Karolinska University Hospital, SE-171 76 Stockholm, Sweden (Correspondence should be addressed to M Lu at Department of Molecular Medicine and Surgery, Karolinska Institutet, Karolinska University Hospital; Email: [email protected]) Abstract 2C 2C Intracellular calcium ([Ca ]i) is the most relevant modulator adenoma cells in spite of increased [Ca ]i. The inhibitory C of parathyroid hormone (PTH) secretion. Uniquely, an effect of Ca2 calmodulin on PTH secretion may be due to 2C increase in [Ca ]i results in an inhibition of PTH secretion, the absence of synaptotagmin 1 protein in parathyroid and it probably exerts its function via calcium-binding protein adenomas, as demonstrated by western blot analysis. An pathways. The ubiquitous calcium-binding proteins, calmo- increased extracellular calcium level acutely lowered the dulin and calmodulin-dependent protein kinase II (CaMKII), amount of active phosphorylated CaMKII (pCaMKII) in have well-established roles in regulated exocytosis in neurons adenoma cells in vitro, indicating the physiological importance and neuroendocrine cells. However, their roles in parathyroid of this pathway. Moreover, a negative correlation between the cells and PTH secretion are still unclear. Using reverse levels of pCaMKII in parathyroid adenomas and serum transcription-PCR and western blot analysis, we have calcium was found in 20 patients with primary hyper- demonstrated the expression of calmodulin and CaMKII in parathyroidism. Taken together, these results show that human normal parathyroid and parathyroid chief cell calmodulin negatively contributes to the regulation of PTH adenomas. Blocking of calmodulin and CaMKII activity by secretion in parathyroid adenoma, at least partially via a the specific antagonists calmidazolium and KN-62 respect- CaMKII pathway. ively caused a rise in PTH secretion from parathyroid Journal of Endocrinology (2011) 208, 31–39 2C Introduction In addition to that, the mechanism behind [Ca ]i increase and PTH inhibition remains unclear. The parathyroid glands are important organs for calcium Calmodulin is a calcium-binding protein involved in 2C regulation in the human body. Parathyroid cells sense small the sensing of increased [Ca ]i concentrations and subse- changes in serum calcium levels and adjust parathyroid quent signal transduction to a variety of cellular targets. hormone (PTH) secretion to keep serum calcium within a Calmodulin-dependent protein kinase II (CaMKII) is a narrow range. In this sense, parathyroid cells are unique calmodulin-binding protein participating in functions such as 2C 2C 2C because intracellular Ca ([Ca ]i) inhibits PTH secretion, exocytosis, [Ca ]i oscillation, and ion-channel activation instead of stimulating secretion as in other endocrine cell (Wang 2008). Calmodulin is ubiquitously expressed and has types (Shoback et al. 1983). The calcium-sensing receptor been detected in both normal and pathological parathyroid (CaSR) is a G-protein-coupled receptor located in the cell (Brown et al. 1981). However, a correlation between levels of 2C membrane. Upon binding of extracellular calcium ([Ca ]e) calmodulin expression, calcium sensitivity, and PTH to CaSR, a phospholipase C–inositol triphosphate pathway is secretion has not been demonstrated (Brown et al. 1981, 2C activated, resulting in several fold increase in [Ca ]i and Oldham et al. 1982). Expression of CaMKII has also been 2C subsequent inhibition of PTH secretion. [Ca ]i has been reported in hyperfunctioning human parathyroid cells established as the central second messenger for PTH secretion where modulation of CaMKII activity was found to be (Shoback et al. 1984), involving, e.g. the PLA2-AA and the calcium and calmodulin dependent (Kinder et al. 1987, Kato MAP kinase pathways (Kifor et al. 2001, Almaden et al. 2002). et al. 1991). However, the interaction between calcium, Journal of Endocrinology (2011) 208, 31–39 DOI: 10.1677/JOE-10-0123 0022–0795/11/0208–031 q 2011 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org Downloaded from Bioscientifica.com at 09/24/2021 10:54:46PM via free access 32 MLUand others . Calmodulin and CaMKII in parathyroid adenomas calmodulin, and CaMKII in human parathyroid has not several transcript variants due to alternative splicing. Primers been clarified. In this study, we have investigated the were designed based on the common sequence of each gene; relationship between calmodulin and CaMKII activity and therefore, it does not identify specific transcript variants. PTH secretion. The PCR reactions were performed in 20 ml reactions with amplification conditions as follows: initial denaturation for 2 min at 94 8C, followed by 40 cycles of 30 s at 95 8C, 30 s at 50–55 8C, and 1 min at 68 8C. Human brain cDNA Materials and Methods (Invitrogen, Cat. no. B1110033) was used as a positive control. The PCR products were subsequently size verified by agarose Parathyroid tissue samples gel electrophoresis and were observed and photographed Normal parathyroid tissue and parathyroid adenomas were under u.v. light. Tofurther verify the quality,all PCR products collected with informed consent and ethical approval at the were purified using a PCR purification kit (Qiagen, Cat. Karolinska University Hospital, Sweden. Histopathological no. Q28104) and were sequenced with the assistance of the diagnoses were according to the WHO classification (DeLellis KISeq core facility at Karolinska Institutet, Stockholm, Sweden. et al. 2004). Histopathological examination of representative sections verified a high tumor cell content of the analyzed Western blot analysis tissue samples. Twenty previously published parathyroid chief cell adenomas and one normal parathyroid biopsy specimen (Lu et al. 2008) Reverse transcription-PCR were used for western blot analysis (No. 1–20, Table 2), using The reverse transcription (RT)-PCR analysis included previously described methodology (Lu et al. 2008). Total previously published samples of one normal parathyroid proteins were extracted using 1% NP-40 lysis buffer supplied ( Juhlin et al. 2010), and four or more parathyroid adenoma with protease inhibitors, and then quantified with a Bio-Rad samples (Lu et al. 2010) for each gene analyzed. Total RNA protein assay. Following separation by SDS–PAGE, proteins was extracted using TRIzol reagent (Invitrogen), purified by were blotted onto nitrocellulose membranes and incubated DNAse I (Amplification Grade, Invitrogen), and quantified overnight at 4 8C with primary antibodies, followed by by spectrophotometry. Total RNA (3 mg) from each sample appropriate secondary antibodies. The following primary was reverse transcribed into 40 ml cDNA using the Super- antibodies and dilutions were applied: monoclonal rabbit Script III First-Strand Synthesis System for RT-PCR anti-calmodulin that targets the single calmodulin protein (Invitrogen, Cat. no. 18080-051). In all, 2 ml of each cDNA commonly encoded by the CALM1, CALM2, and CALM3 were used for amplification of calmodulin 1, 2, and 3 genes genes (EP799Y, Abcam, Cambridge, UK, Cat. no. ab45689) (CALM1, CALM2, and CALM3) and of CaMKII a, b, g, at dilution 1:1000; polyclonal anti-endogenous CaMKII and d genes (CAMK2A, CAMK2B, CAMK2G,and antibody that detects total CaMKII a and b subunits levels CAMK2D) with the Platinum Taq DNA polymerase high- (Acris, Herford, Germany, Cat. No. AP02774PU-S) at 1:500; fidelity kit (Invitrogen). Gene-specific forward and reverse polyclonal anti-CaMKIIp-Thr286 antibody specific for the PCR primers (Table 1) were designed in house according to phosphorylated form of CaMKII a and b subunits published genomic data and PCR primer design guidelines. (pCaMKII, Acris, Cat. no. AP2526PU-S) at 1:800; mono- CAMK2A, CAMK2B, CAMK2G, and CAMK2D have clonal anti-synaptotagmin 1 antibody (SYSY, Goettingen, Table 1 Details and primers used for reverse transcription-PCR of the CALM1–3 and CAMK2A, CAMK2B, CAMK2G, and CAMK2D genes Gene Gene Protein Primer Amplicon Annealing symbol location product orientation Primer sequence (50–30) length (bp) temperature (8C) CALM1 14q24–q31 Calmodulin Forward CAGATATTGATGGAGACGGA 629 51 Reverse GAGCACACGAAGTACAAGAG CALM2 2p21 Calmodulin Forward GACAAAGATGGTGATGGAAC 394 51 Reverse GTCTTCACTTTGCTGTCATC CALM3 19q13.2 Calmodulin Forward ACAAGGATGGAGATGGCAC 313 57 Reverse ATCTCATCCACCTCCTCATC CAMK2A 5q32 CaMKII a subunit Forward ACCAGCTCTTCGAGGAATTG 241 56 Reverse GTGACCAGGTCGAAGATCAG CAMK2B 7p14.3 CaMKII b subunit Forward GAGAGAGAGGCTCGGATCTG 395 56 Reverse TGTCCACAGGCTTGCCATAC CAMK2G 10q22 CaMKII g subunit Forward GACTTCTGAAACATCCAAAC 431 55 Reverse CACCAGGAGGATATACAGGA CAMK2D 4q26 CaMKII d subunit Forward TAGCAAATCCAAGGGAGCAG 377 55 Reverse ATGGGTGCTTCAGTGCCTC Journal of Endocrinology (2011) 208, 31–39 www.endocrinology-journals.org Downloaded from Bioscientifica.com at 09/24/2021 10:54:46PM via free access Calmodulin and CaMKII