(SNCAIP) (NM 005460) Human 3' UTR Clone Product Data

(SNCAIP) (NM 005460) Human 3' UTR Clone Product Data

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC207980 Synphilin 1 (SNCAIP) (NM_005460) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: Synphilin 1 (SNCAIP) (NM_005460) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: SNCAIP Synonyms: Sph1; SYPH1 ACCN: NM_005460 Insert Size: 753 bp Insert Sequence: >SC207980 3’UTR clone of NM_005460 The sequence shown below is from the reference sequence of NM_005460. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC GCTAGCAAAGGAAAGAATAAGGCAGCATAATGACATCAATAGAAAAATGAAGAAATCCTACAGCATAAA GCACATTGCTGAGCCAGAGTCAAAAGAACTCTTCTTGTAAATCACTTTTTAAATTTTCTCTCACTGATG CCCTTTGGAAATTATTGGAAATTTCTGGACTATCCTCTTTGGAAAGAGAACCATGAAAACAATGCCTCA CCAGCAGAAGAACAGAATATCAGGATGCCTTAAATTTATAGTAGTAGACTGTAAAAGATTCATTTTGGG GTGATATCTGTATATATAACTTGTTTTTTTAAAAGATGCCGTTTAAAAGCATGATTGGGAAAATGTATG TTTTTTAAGAGTAGATTGATTCACCCTACCCACAGGACATTCACCAAGCCACTGATACCATTTTATATT TCATCAATTGCATGAGTATTTGCTAATGTTGATTGAACCTCCCTTTCCCCATAATGTGGGCAGATTTGG CTCAGCTCCTTCATGAGATCAGGTCAGTGGTATTGTTTCTGTCAAGAGTGTTTTTTCTGTCATTTCTAC TTTTTGTATAAAGGAAATAAAACAATGTTAACAGCCACCTATAAGCTTGGGGCACCTACTTTCTAACAA ATCTGTGATGTTCTGATTTCTAAGGGACTTTGCAAGTATTTTGATTGCTGATATTTGATTTCAGGAACA AACTGCTCAGTTTAGCAGTTTTCCCATAGGCGTCAAATAAAACATTCTATATTTCATTAAGTA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_005460.4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Synphilin 1 (SNCAIP) (NM_005460) Human 3' UTR Clone – SC207980 Summary: This gene encodes a protein containing several protein-protein interaction domains, including ankyrin-like repeats, a coiled-coil domain, and an ATP/GTP-binding motif. The encoded protein interacts with alpha-synuclein in neuronal tissue and may play a role in the formation of cytoplasmic inclusions and neurodegeneration. A mutation in this gene has been associated with Parkinson's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015] Locus ID: 9627 MW: 29.4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us