Int. J. Biol. Sci. 2017, Vol. 13 157 Ivyspring International Publisher International Journal of Biological Sciences 2017; 13(2): 157-166. doi: 10.7150/ijbs.17440 Research Paper Regulatory Axis of miR-195/497 and HMGA1–Id3 Governs Muscle Cell Proliferation and Differentiation Huiling Qiu1,2*, Jiasheng Zhong1*, Lan Luo1, Zhixiong Tang1, Nian Liu1, Kang Kang3, Li Li1, Deming Gou1 1. Shenzhen Key Laboratory of Microbial Genetic Engineering, College of Life Sciences, Shenzhen University, Shenzhen, Guangdong, 518060, China. 2. Key Laboratory of Optoelectronic Devices and Systems of Ministry of Education and Guangdong Province, College of Optoelectronic Engineering, Shenzhen University, Shenzhen, Guangdong, 518060, China. 3. Department of Physiology, Shenzhen University Health Science Center, Shenzhen, Guangdong, 518000, China. * These authors contributed equally to this work. Corresponding author: Deming Gou Tel: +86 0755 26527848 Fax: +86 0755 26527848 Email: [email protected]. Present Address: Nanhai Ave 3688, Shenzhen, Guangdong, P. R. China, 518060. © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2016.09.02; Accepted: 2016.11.13; Published: 2017.01.15 Abstract Myocytes withdraw from the cell cycle to differentiate during muscle development. Given the capacity of microRNAs (miRNAs) to regulate gene expression during development, we screened for miRNAs that were associated with muscle development. S-Poly(T) Plus analysis of 273 miRNAs in porcine longissimus dorsi muscles revealed 14 miRNAs that were strongly upregulated with age of postnatal muscle development in vivo, including miR-195 and miR-497. These two miRNAs were also strongly upregulated at late differentiation stages of mouse skeletal myoblast C2C12 cells, and demethylation treatment induced significant upregulation of miR-195/497. Manipulation of miR-195/497 expression resulted in dramatic changes in the proliferation and differentiation of C2C12 cells. We identified high-mobility group AT-hook 1 (Hmga1) mRNA as a highly conserved target of miR-195/497 in C2C12 myoblasts. Overexpression of miR-195/497 or Hmga1 silencing in C2C12 cells promoted myogenic differentiation. Moreover, we showed that miR-195/497 repressed Hmga1, which in turn downregulated one of the HMGA1 downstream targets Id3, whose inhibitory effect on myogenic differentiation is well established. Our study revealed a subset of potential development-associated miRNAs and suggests a novel regulatory axis for myogenesis in which miR-195/497 promote myogenic differentiation by repressing the HMGA1–Id3 pathway. Key words: miR-195/497; Hmga1; myoblast; skeletal muscle; differentiation; proliferation. 1. Introduction Pork is the most widely consumed meat in the myogenin, E-proteins, and myocyte enhancer factor 2 world. In the field of biomedicine, pigs are (MEF2) [4]. MicroRNAs (miRNAs) are involved in anatomically and physiologically analogous to regulating various biological processes, including cell humans. Knowledge of muscle development in pigs is proliferation and differentiation, and the function of a important to improve production and quality of pork subset of miRNAs during muscle development has and provides understanding of human muscle been well established [5]. disease. Myogenesis is an important biological Clearly, a complete understanding of the roles of process in all stages of skeletal muscle growth [1, 2]. miRNAs in myogenesis is imperative for elucidating During myogenesis, myoblasts proliferate, withdraw skeletal muscle growth. In this study, we profiled the from the cell cycle, and differentiate to form myotubes expression patterns of 273 miRNAs in longissimus [3]. Myogenesis is a tightly regulated process that is dorsi muscle of pigs during postnatal growth and promoted mainly by basic helix-loop-helix (bHLH) identified a set of development-associated miRNAs. factors including MyoD, myogenic factor 5, Of these, miR-195 and miR-497 (hereafter called http://www.ijbs.com Int. J. Biol. Sci. 2017, Vol. 13 158 miR-195/497) were strongly upregulated in an 2.3. Plasmid construction age-dependent manner. MiR-195/497 are known Hmga1 3′UTR luciferase reporter: To construct cancer repressors that govern the expression of many the Hmga1 3’UTR luciferase reporter plasmid, the cell-cycle-associated genes [6-8]. Recently, wild-type Hmga1 3′UTR sequence was amplified from miR-195/497-mediated myogenic proliferation and mouse genomic DNA using primers Hmga1-UTR- renewal have been characterized during muscle Wt-F (5′-CCAGAATTCACTTGTCAGCCTTGAAGCA development [9, 10]. Here, we revealed the role of TCGGAG-3′) and Hmga1-UTR-Wt-R (5′-CCACTGAG miR-195/497 in myotube formation during CATGGGGGAAGGAAATCAATGAGTG-3′). The myogenesis. PCR products were then subcloned into the The high-mobility group A1 gene (Hmga1) is an downstream region of the Firefly luciferase reporter architectural transcription factor that participates in gene of the miRGlo vector (Promega, Madison, WI, various nuclear processes that modulate numerous USA). Hmga1-UTR mutants were generated by biological processes, including myogenic site-directed mutagenesis using primers differentiation [11, 12]. In this study, manipulating the Hmga1-UTR-Mut-F (5′-ATGTTCATTCTTAGATAC activity of miR-195/497 showed that they regulate the CCACTATTGCTGCTGCTACCAGCGTCAGATGTT- Hmga1 expression in muscle cells. We found that in 3′) and Hmga1-UTR-Mut-R (5′-CAGGAGGATGAAC myoblasts, HMGA1 induced the expression of Id3, ATCTGACGCTGGTAGCAGCAGCAATAGTGGGT one of the major repressors of cell differentiation. ATCTAA-3′). Myogenin promoter luciferase assay: The mouse 2. Material and methods myogenin promoter was subcloned into the vector 2.1. Cell culture pGL4 (Promega, Madison, WI, USA) at the XhoI-MluI sites. The myogenin promoter was amplified from Human embryonic kidney cell lines HEK293T mouse genomic DNA using primers MyoG-Pro-F and mouse skeletal myoblast C2C12 cells were (5'-CCACTCGAGGTCTCTAGCTGCATATGTAGCA obtained from the American Type Culture Collection GAAGATGG-3') and MyoG-Pro-R (5'-GGTACGCGT and maintained in Dulbecco's modified Eagle's CAGGTCGCAAAAGGCTTGTTCCTGCCACTG-3'). medium (DMEM; Corning Cellgro, Manassas, VA, Hmga1 overexpression plasmid: The sequences USA) containing 10% fetal bovine serum (FBS, of wild-type Hmga1 were amplified from the cDNA Biowest, Nuaillè, France) in a humidified incubator from C2C12 cells using primers Hmga1-F with 5% CO2 at 37°C. Mouse C2C12 myoblasts were (5′-CACCGAATTCAGTCGGGGCTATTTCTGGTGTT transferred to DMEM containing 2% horse serum GGC-3′) and Hmga1-R (5′-CACCGGATCCGCTGGTG (Gibco, Grand Island, NY, USA) to initiate CCTGGTGCGGTAGTGTGC-3′). The PCR products differentiation and mimic normal myogenesis. were then subcloned into the pLVX-puro vector 2.2. Animals and muscle collection (Clontech, Mountain View, CA, USA). The castrated male hybrid pigs (Landrace × Hmga1 shRNA plasmids. Plasmid vectors Large White × Duroc) were obtained from College of containing shRNA targeted to Hmga1 and nonspecific Animal Science of South China Agricultural control (sh-NC) were constructed based on pLVX-hU6 University. Feeding conditions and experimental vector. The target sequences of sh-Hmga1-1 and designs have been detailed in the study of Wu et al. sh-Hmga1-2 were 5'-AAGTCACCACAGCTCCAGGG [13]. Briefly, the pigs were housed in a controlled A-3' and 5'-GTGAAGTGCCAACTCCGAAGA-3'. environment and were provided free access to food miRNA dTuD inhibitor plasmids: miRNA and water according to the NRC2012 (Nutrient inhibitors against miR-195 or miR-497 were generated requirements of swine, 2012). We collected the using the two-step PCR method as detailed in our porcine longissimus dorsi muscles at postnatal days previous study [14]. 35 (weaning), 63 (nursery), 98 (grow-finish), and 161 2.4. Lentivirus packaging and transduction (reach market weight) with six pigs in each group. HEK293T cells were used to package lentiviral The C57BL/6 male mice were purchased from the particles. Briefly, the cells were transfected using Guangdong Medical Laboratory Animal Center. poly-ethylenimine (PEI) transfection reagent with the Mouse skeletal muscles were collected at postnatal packing plasmids (17.1 µg) in a ratio of 3:1:3 as days 2 (newborn), 14 (suckling), 28 (weaning), 42 follows: psPAX2 encoding HIV Gag-Pol (Addgene (sexually mature) and 63 (adult). All the protocols 12260; Addgene, Cambridge, MA, USA), pVSVg were approved by the Animal Ethical and Welfare encoding the VSV-G glycoprotein (Addgene 8454; Committee of Shenzhen University (Approval No. Addgene, Cambridge, MA, USA), and a lentiviral AEWC-2014-001004). vector (6.9 µg). At 48 h and 72 h after transfection, the http://www.ijbs.com Int. J. Biol. Sci. 2017, Vol. 13 159 cell-free supernatants were harvested and used for (Roche, Mannheim, Germany). Protein concentration cell infection using 8 ng/ml of polybrene. was determined using a bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, Beijing, USA). 2.5. Fluorescence reporter assays The primary antibodies used are as follows: β-tubulin For the myogenin promoter reporter assay, (Cat #10094-1-AP, 1:5,000; Proteintech, Wuhan, C2C12 cells were transfected with myogenin Hubei, China), myogenin (Cat # ab1835, 1:2000; promoter luciferase reporter plasmids (100 ng), Abcam, Cambridge, MA, USA), HMGA1 (Cat miRNA mimics (100 µM),