CKS2 (NM 001827) Human Untagged Clone – SC127099 | Origene

CKS2 (NM 001827) Human Untagged Clone – SC127099 | Origene

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC127099 CKS2 (NM_001827) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CKS2 (NM_001827) Human Untagged Clone Tag: Tag Free Symbol: CKS2 Synonyms: CKSHS2 Vector: pCMV6-XL6 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC127099 sequence for NM_001827 edited (data generated by NextGen Sequencing) ATGGCCCACAAGCAGATCTACTACTCGGACAAGTACTTCGACGAACACTACGAGTACCGG CATGTTATGTTACCCAGAGAACTTTCCAAACAAGTACCTAAAACTCATCTGATGTCTGAA GAGGAGTGGAGGAGACTTGGTGTCCAACAGAGTCTAGGCTGGGTTCATTACATGATTCAT GAGCCAGAACCACATATTCTTCTCTTTAGACGACCTCTTCCAAAAGATCAACAAAAATGA Clone variation with respect to NM_001827.1 5' Read Nucleotide >OriGene 5' read for NM_001827 unedited Sequence: NTTATTTCCCCGCCCGTTGNCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATA AGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCC GCGAATTCGGCACGAGGCGAGTTGTTGCCTGGGCTGGACGTGGTTTTGTCTGCTGCGCCC GCTCTTCGCGCTCTCGTTTCATTTTCTGCAGCGCGCCAGCAGGATGGCCCACAAGCAGAT CTACTACTCGGACAAGTACTTCGACGAACACTACGAGTACCGGCATGTTATGTTACCCAG AGAACTTTCCAAACAAGTACCTAAAACTCATCTGATGTCTGAAGAGGAGTGGAGGAGACT TGGTGTCCAACAGAGTCTAGGCTGGGTTCATTACATGATTCATGAGCCAGAACCACATAT TCTTCTCTTTAGACGACCTCTTCCAAAAGATCAACAAAAATGAAGTTTATCTGGGGATCG TCAAATCTTTTTCAAATTTAATGTATATGTGTATATAAGGTAGTATTCAGTGAATACTTG AGAAATGTACAAATCCTTCATCCATACCTGTGCATGAGCTGTATTCTTCACAGCAACAGA GCTCAGTTAAATGCAACTGCAAGTAGGTTACTGTAAGATGTTTAAGATAAAAGTTCTTCC AGTCAGTTNTTCTCTTAAGTGCCTGTTTGAGTTTACTGAAACAGTTTACTTTTGTTCAAA TAAAGTTGTATGTTGCATTTAAAAAAAAAAAAAAAAAACTCGACTCTAGATTGCGGNCGC GGTCATAGCTGGNTCCCTGACAGATCCCGGGTGGCATCCCTGTGACCCTNCCCAGTGCCC TCTCTGGCCCTGNNNAGTGCCACTNCAGTGCCCACCAGCCNTTGTCTATAAAAATAAAGT GCATCATTTTGCTGACTAGA Restriction Sites: NotI-NotI This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CKS2 (NM_001827) Human Untagged Clone – SC127099 ACCN: NM_001827 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001827.1, NP_001818.1 RefSeq Size: 627 bp RefSeq ORF: 240 bp Locus ID: 1164 UniProt ID: P33552 Domains: CKS Protein Families: Druggable Genome, Stem cell - Pluripotency Gene Summary: CKS2 protein binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. The CKS2 mRNA is found to be expressed in different patterns through the cell cycle in HeLa cells, which reflects specialized role for the encoded protein. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us