Diversification of the livebearing Mexican Goodeidae: Pattern and process in macroevolution Shane A. Webb, Ph.D. Department of Biology Acknowledgments Mike Ritchie, Jeff Graves & Anne Magurran University of St. Andrews, Scotland Diarmaid O’Foighil and LMS, UMMZ Constantino Macias G. & Edgar Avila L., UNAM ALA, Jim Langhammer, Juan Migual Artigas A., John Lyons Department of Biology and School of Science & Health Professions, NGCSU Talk coverage Ritchie, M., R.M. Hamill, J.A. Graves, A.E. Magurran, S.A. Webb, and C. Macias-Garcia. 2007. Sex and differentiation; Population genetic divergence and sexual dimorphism in Mexican goodeid fish. J. Evol. Bio. 20(5): 2048-2055. Ritchie, M.G., Webb, S.A., Graves, J.A., Magurran, A.E. and Macías Garcia, C. 2005. Patterns of speciation in Mexican Goodeid fish: Sexual conflict or adaptive radiation? J. Evol. Bio. 18(4): 922-929. Webb, S.A., J.A. Graves, C. Macias-Garcia, A.E. Magurran, D. Ó Foighil, & M.G. Ritchie. 2004. Molecular phylogeny of the live-bearing Goodeidae (Cyprinodontiformes). Mol. Phyl. Evol. 30: 527-544. Patterns • Why are there many species in some places? Are there special places? • The U.S. has 10-35 fish species per drainage system along the active margin, but these are members of ~12 different fish groups. • In Mexico the Goodeidae contains ~40 species Process Or are there special processes? Sexual selection • Described by Darwin (Origin and Descent) – Male-male competition (intrasexual) weapons – Female mate choice (intersexual) ornaments • Positive feedback (Fisher) • Handicap principle (Hamilton et al.) • Good genes / “bright” male (Hamilton & Zuk) • Sensory exploitation (Ryan) • Etc. Objectives I. Build a molecular phylogeny of the Goodeidae (historical biology based on inference) and compare results with previous work II. Determine patterns of diversification within this natural group III. Try to infer the processes important in diversification of this group Introduction to the Goodeidae • Composition and some natural history • Sexual selection and diversification Methods • Datasets and phylogenetic analyses • Calculation of the goodeid molecular clock • Quantifying sexual dimorphism Results and Discussion • Phylogeny • Patterns of divergence and the role of geologic events in diversification • A role for sexual selection? INTRODUCTION Diversity and natural history Sexual selection and diversification Map Profundulus Empetrichthyinae Goodeinae Crenichthys baileyi Empetrichthyinae Empetrichthys latos Image courtesy of Dr. Paul Loiselle Pahrump Valley, NV, USA Photo by J. Deacon Goodeinae MTB Michoacan, Mexico Hubbsina turneri (male) Characodon lateralis (male) Image courtesy of C. Grimes Image courtesy of ALA Skiffia lermae (male) Ilyodon furcidens (male) viviparity Girardinichthys viviparus (female) matrotrophy Lombardi & Wourms 1985 matrotrophy (embryogenesis) 40 35 ↑15,000% 30 other species Ameca 25 ↑ 2,700-39,000% 20 15 Dry weightDry (mg) 10 5 ↑1,000% Goodea 0 0 2 4 6 8 10 12 14 16 18 20 Standard length (mm) Lombardi & Wourms 1988 sexual dimorphism ♀ ♂ Skiffia multipunctata costly ornaments Presa de Orandino, Michoacan predation by Thamnophis prediction Degree of sexual dimorphism should correlate with diversity Arnqvist et al. 2000; Gavrilets et al. 2001; Martin & Hosken 2003 i.e. Sexually dimorphic groups should be more speciose (possess higher speciation rates) HO : Species richness is independent of sexual dimorphism. If no correlation, what is the pattern of speciation in the group? Is most speciation allopatric? Not necessarily exclusive of sexual selection. What is the rate of speciation? Is speciation clocklike (i.e. relatively constant through time)? METHODS dataset 1 mtDNA sequence data • Uniparentally inherited (maternal) • Evolves rapidly (doesn’t recombine) • Protein coding and non-coding regions • Circular dsDNA molecule (~16kb) • COI (627 bp) and Control region (~400 bp) of 37 taxa DNA protocol • DNA extraction from tissues • PCR Amplification of desired loci • Fragment isolation • Sequencing reactions • Autosequencing • Proofreading 2 strands aligned sequence data (mtCOI) Allodhub TATTTAGTATTTGGTGCCTGAGCCGGCATAGTTGGTACCGCCCTAA Allodzon .................T..........................G. Alloorob ...................................C........T. Allotcat ..........................T...........T....... Allotdug ...................................C..T...T... Amspl ..........................T........C.......... Ataentow .................T..............G.....T....... Chapenc ..........................T........C.......... Charaud .......................T..T................... Charlat .......................T..T........C.......... Girmult ......C....................................... Girviv ..........C................................... Gooatr ...................................C.......... Hubtur ..........................T...............T... Ilyfur .............................................. Skifbil .................T.................C.......... Skiffran ....................G..............C.......... Skifmult ....................G..............C.......... Xenocapt ..........................T........C.......... Xenres ...C......................T.................GT Xenvar ..........................T........C.......... Zoogquit ..........................T.....G............. 123..3..3..3..3..3..3..3..3..3..3..3..3..3..3. phylogenetic analyses • Outgroup – close relatives outside group – Profundulus labialis • Ingroup – 36 species of goodeines • Parsimony analysis (PAUP 4) – Heuristic searches – 20 random stepwise addition replicates dataset 2 sexual dimorphism • Standard length • Dorsal, caudal, and • Mid body depth anal-fin heights • Body depth at • D-, C- & A-fin areas midpoint of dorsal fin • D- & A-fin bases Caveat: No measurement of color or behavior in our analyses Mahalanobis distance • Multivariate • Discriminant function analysis DM females males quantifying dimorphism more dimorphic DM less dimorphic DM females males dataset 3 microsatellite data • 5-7 neutral loci were employed for each of four species that vary in sexual dimorphism – (X. melanosoma, C. lateralis, Z. quitzeoensis, G. atripinnis) • Genotypes were determined for 30 individuals (15males / 15females) of each species from four populations • FST was calculated and adjusted for geographic distances among populations Loci from Boto & Doadrio 2003 and Hamill et al. 2007 population 1 FST population 2 a b a a b a a b b b a = 1 a b b a a b = 0.5 b a a b a b b a pop. subdivision accounts for a ~50% of the total variation b b (due to genetic drift?) b a a a b a a a = 0 a b b b b b b a RESULTS & DISCUSSION molecular phylogeny (mtCOI + CR) dataset 1 Webb et al. 2004 extreme fin dimorphism riverine clade hypothesis of Hubbs and Turner 1939 Girardinichthyinae Allodontichthys Goodeinae Ilyodon Characodontinae Xenotaenia Ataeniobiinae Alloophorus undescribed Chapalichthys Ameca Xenotoca variata Xenoophorus "Xenotoca" Zoogoneticus Goodea Allotoca Girardinichthys Hubbsina Skiffia Ataeniobius Characodon hypothesis of Smith 1980 Allodontichthys Ilyodon Characodon group Xenotaenia Goodea group Alloophorus Chapalichthys Ameca Xenotoca variata Xenoophorus "Xenotoca" Zoogoneticus Goodea Allotoca Girardinichthys Hubbsina Skiffia Ataeniobius Characodon Empetrichthyinae Profundulus goodeine molecular clock (mtCOI) • Calibrated with fossil and geological data: – Alloophorus, Ameca, Chapalichthys encaustus, Goodea atripinnis fossils are mid-late Pleistocene (250 kya; Smith et al. 1975) – Allopatric speciation of Girardinichthys (Sierra Madre de las Cruces ~5 Mya; Barbour 1973) – †Tapatia occidentalis (sister group of girardinichthyins) fossils dated as late Miocene (~6 Mya; Smith 1980, Smith & Miller 1986) • Corrected divergence (%) time of event • Denominator is an underestimate with fossils, but shouldn’t affect overall relationship (slope) 0.18 0.9% per million years 0.16 y = 0.0091x + 0.0482 0.14 R2 = 0.401 †Tapatia 0.12 0.1 Goodea atripinnis Nei distance Nei - 0.08 Alloophorus 0.06 Girardinichthys Tamura 0.04 Ameca Chapalichthys 0.02 encaustus 0 0 1 2 3 4 5 6 time (mya) chronology of speciation events Tamura-Nei sequence divergence (%) Time (Mya) you are here from Webb et al. 2004 dataset 1 time to speciation 0.3 rank cc = 0.462 ) p = 0.007 Internode interval 0.2 increasing through time 0.1 Speciation Waitingtime ( not clocklike. 0.0 0 10 20 30 40 Lineages from Ritchie et al. 2005 lineages through time plot dataset 1 runs test rejects linearity Recent p < 0.0001 extinction? Early radiation? affected by speciation and extinction from Ritchie et al. 2005 datasets 1&2 sexual dimorphism and speciation 1.863 1.367, 1 1.785 1.931, 2 1.359, 3 2.273 2.689, 4 2.158 1.965, 5 2.257 2.157 1.902, 6 2.163 2.356 2.117, 7 2.619, 8 2.104 1.886, 9 2.228 2.044, 10 2.412 2.273 2.660, 11 2.537 2.760, 12 2.496, 13 2.182 2.149, 14 2.263 2.331 2.202, 15 2.407 2.581, 16 2.304 2.398 2.252, 17 2.509, 18 2.465 10 2.342 2.615, 19 2.333 2.502, 20 6 2.245, 21 2.357 2.246, 22 12:4 sig. 2.488, 23 2.407 2.468, 24 2.407, 25 p = 0.14 from Ritchie et al. 2005 Does not reject HO dataset 3 FST vs. geographic distance 0.75 FST dependent on dimorphism X. mel p = 0.028 C. lat. 0.50 G. atr. Z. quit. Fst 0.25 Rejects HO 0.00 0 100 200 300 400 Distance (Km) from Ritchie et al. 2007 Conclusions • The goodeid “clock” suggests the group is ~16.8 Myrs old, the Goodeinae is 14.9 Myrs old, and that approximately 3/4 of goodeine divergence events occurred during the Miocene (i.e. older). • All goodeine genera but Xenotoca are monophyletic. Findings