Cancer Microenvironment and Immunology Research Endoplasmic Reticulum Stress Protein GRP78 Modulates Lipid Metabolism to Control Drug Sensitivity and Antitumor Immunity in Breast Cancer Katherine L. Cook1,2, David R. Soto-Pantoja1, Pamela A.G. Clarke2, M. Idalia Cruz2, Alan Zwart2, Anni Warri€ 2, Leena Hilakivi-Clarke2, David D. Roberts3, and Robert Clarke2 Abstract The unfolded protein response is an endoplasmic reticulum of GRP78-regulated metabolite changes by treating tumor-bear- stress pathway mediated by the protein chaperone glucose regu- ing mice with tamoxifen and/or linoleic acid. Tumors treated with lated-protein 78 (GRP78). Metabolic analysis of breast cancer linoleic acid plus tamoxifen exhibited reduced tumor area and cells shows that GRP78 silencing increases the intracellular con- tumor weight. Inhibition of either GRP78 or linoleic acid treat- centrations of essential polyunsaturated fats, including linoleic ment increased MCP-1 serum levels, decreased CD47 expression, acid. Accumulation of fatty acids is due to an inhibition of and increased macrophage infiltration, suggesting a novel role for mitochondrial fatty acid transport, resulting in a reduction GRP78 in regulating innate immunity. GRP78 control of fatty acid of fatty acid oxidation. These data suggest a novel role of oxidation may represent a new homeostatic function for GRP78. GRP78-mediating cellular metabolism. We validated the effect Cancer Res; 76(19); 5657–70. Ó2016 AACR. Introduction translocate to the Golgi complex where it is cleaved by site 1 and 2 proteases (S1P and S2P) to form the activated ATF6 Glucose-regulated protein 78 (GRP78) is a protein chaper- transcription factor. Activation of the UPR controls various cell onethatactsasamasterregulatoroftheunfoldedprotein signaling pathways, including cap-dependent protein transla- response (UPR; refs. 1, 2). In the absence of stress, GRP78 is tion,cellcycle,apoptosis,autophagy,transcriptionofprotein primarily bound to the three protein effectors of each UPR arm, chaperones, antioxidant response, among other responses. inositol requiring enzyme 1 (ERN1; IRE1), PKR-like endoplas- Although activation of the UPR is initially prosurvival, pro- mic reticulum kinase (EIF2AK3; PERK), and activating tran- longed UPR activation can lead to cell death (1, 2). scription factor 6 (ATF6). These heterodimers remain inactive Breast cancers exhibit increased activation of several UPR in the endoplasmic reticulum membrane until released from signaling components (4–6). Furthermore, some breast cancer GRP78. Release occurs following the accumulation of unfold- therapies, such as tamoxifen (TAM) and faslodex (fulvestrant, ICI) ed/misfolded proteins within the endoplasmic reticulum, þ used in the management of estrogen receptor–positive (ER ) allowing induction of the UPR. Stimulation of IRE1 results in breast cancers, stimulate UPR signaling to promote cell survival the unconventional splicing of X-box–binding protein 1 and drug resistance (7). Antiestrogen-resistant breast cancer cell (XBP1), leading to production of the active transcription factor lines express elevated levels of both GRP78 and XBP1, suggesting XBP1-S and its related signaling (3). Activated PERK can phos- UPR activation as a driver of endocrine therapy resistance (8, 9). phorylate eIF2a, inhibiting cap-dependent protein translation þ Treatment of ER breast cancer cells with antiestrogens can cause and promoting the translation of activating transcription factor the accumulation of inactive ERa within the cell (10, 11). Abla- 4(ATF4) and DNA damage-inducible transcript 3 (DDIT3; tion of ERa through RNAi inhibited antiestrogen therapy-medi- CHOP). The release of GRP78 from ATF6 enables ATF6 to ated UPR activation (7). Thus, accumulation of ERa can stimulate UPR signaling. Inhibiting GRP78 using RNAi can potentiate antiestrogen responses in sensitive cells and at least partly restore 1 Department of Surgery and Hypertension and Vascular Research sensitivity in resistant cells. We also showed that inhibition of Center, Wake Forest University School of Medicine, Winston-Salem, North Carolina. 2Department of Oncology and Lombardi Comprehen- GRP78 prevented antiestrogen-mediated autophagy induction sive Cancer Center, Georgetown University Medical Center, Washing- through regulation of AMPK (8, 12), suggesting that targeting 3 ton, DC. Laboratory of Pathology, National Cancer Institute, NIH, GRP78 may affect other AMPK-regulated functions such as cel- Bethesda, Maryland. lular metabolism (13). Note: Supplementary data for this article are available at Cancer Research Using a GRP78-targeting morpholino, for the first time we Online (http://cancerres.aacrjournals.org/). show that in vivo inhibition of GRP78 potentiates tamoxifen þ Corresponding Author: Katherine L. Cook, Wake Forest University, Medical sensitivity in ER breast tumors and can restore sensitivity in Center Boulevard, Winston-Salem, NC 27157. Phone: 336-716-2234; Fax: 336- resistant tumors. Diverging from GRP780s canonical role in UPR 716-1456; E-mail: [email protected] signaling, metabolomics analysis shows a novel role of GRP78 in doi: 10.1158/0008-5472.CAN-15-2616 regulating lipid metabolism. For example, we now show that Ó2016 American Association for Cancer Research. supplementation of the GRP78-regulated metabolite linoleic acid www.aacrjournals.org 5657 Downloaded from cancerres.aacrjournals.org on October 5, 2021. © 2016 American Association for Cancer Research. Cook et al. (LA), a polyunsaturated omega-6 fatty acid, restores endocrine and/or 1 mmol/L NAC (antioxidant). On day 3 or 6, media therapy sensitivity in vivo. We further show that GRP78 inhibition were aspirated and cells were stained with crystal violet, permea- prevents mitochondrial lipid transportation through a reduction bilized in citrate buffer, and absorbance was read at 480 nm of CPT1A that limits fatty acid oxidation and increases lipid using a plate reader. accumulation, peroxidation, and reactive oxygen species (ROS) generation. Moreover, in vivo supplementation with LA in com- Metabolomics bination with tamoxifen produced a greater inhibition of tumor Metabolite analysis was performed by Metabolon; see Supple- growth than does treatment with tamoxifen alone. These data mentary Experimental Procedures. suggest that LA regulation by GRP78 mediates, at least partly, the antitumor activity of the GRP78 morpholino. We also show, for Inhibition of GRP78 in vivo xenograft mouse models the first time, that GRP78 inhibition in BALB/c mice and in Five-week-old ovariectomized athymic nude mice (Harlan Lab- athymic tumor-bearing mice treated with human-targeting oratories) were injected orthotopically into the mammary fat pads GRP78 morpholino or the GRP78-regulated metabolite (LA) with a suspension of 1 Â 106 LCC1 or LCC9 cells in Matrigel. Mice supplementation, regulates CD47 expression and stimulates an were supplemented with subcutaneous implantation of a 17b- innate immune response, which includes increase macrophage estradiol pellet (0.36 mg, 60-day release; Innovative Research of þ infiltration, to reduce ER tumor growth. America). Once tumors obtained an area of 30 to 40 mm2, mice were treated every 3 days with an intraperitoneal injection of Materials and Methods 250 mLof30mmol/L human-specific GRP78 targeting morpho- lino (antisense code: GAGAGCTTCATCTTGCCAGCCAGTT) or Materials mouse-specific GRP78 targeting morpholino (antisense code: The following materials were obtained as indicated: Mouse and GCTCAGCAGTCAGGCAGGAGTCTTA) or a combination of both human specific targeting GRP78 morpholinos (GeneTools); human- and mouse-targeting GRP78 morpholinos in saline. Tamoxifen citrate diet (LabDiet) and 4-OH Tamoxifen (Tocris Where appropriate, some mice were also placed on a 5053 PicoLab Bioscience). Improved Minimal Essential Medium (IMEM; Gibco Rodent Diet 20 containing 400 ppm tamoxifen citrate. Tumors Invitrogen BRL); bovine calf charcoal stripped serum (CCS; Equi- were measured weekly for 4 to 6 weeks. Mice were sacrificed and tech-Bio Inc.); oil-red-O stain and N-acetyl-cysteine (NAC; Sigma- tumors were removed at necropsy, fixed in neutral buffered Aldrich); and crystal violet (Thermo Fisher Scientific). GRP78 formalin, and processed using routine histologic methods. siRNA was obtained from Dharmacon. GRP78 pcDNA was obtained from Origene. ACC inhibitor, TOFA was obtained from Systemic GRP78 inhibition by morpholino Santa Cruz Biotechnology. Antibodies were obtained from the Female, 4-week-old, BALB/c mice were purchased from Harlan. following sources: GRP78, CPT1A, calreticulin, HMBG1, phos- Every 3 days, mice were injected intraperitoneally with 250 mLof pho-ACC, ACC, SCD1, FASN, phospho-AMPK, p110 alpha, phos- 30 mmol/L mouse-specific GRP78-targeting morpholino for 3 pho-Akt, Akt, IRE1, PERK, CHOP, XBP1-S, and MCP-1 (Cell weeks before being euthanized. At necropsy, serum was collected Signaling Technology); CD47 (clone 301, eBioscience); adipo- for cytokine analysis and mammary glands were harvested for phillin (Abbiotec); b-tubulin (Sigma-Aldrich), GRP78 (for IHC), protein and immunohistochemical analysis. b-actin, and polyclonal and horseradish peroxidase–conjugated secondary antibodies (Santa Cruz Biotechnology). Linoleic acid In vivo metabolite replacement model (Tocris) was used for the in vitro studies. Linoleic acid (Sigma Five-week-old ovariectomized athymic nude mice were injected Aldrich) and time release linoleic acid and estrogen pellets were orthotopically into the mammary fat pads with a suspension