Regulation of sterol carrier protein 2 (SCP2) gene expression in rat peritoneal macrophages during foam cell formation. A key role for free cholesterol content. A Hirai, … , Y Tamura, S Yoshida J Clin Invest. 1994;94(6):2215-2223. https://doi.org/10.1172/JCI117583. Research Article Sterol carrier protein 2 (SCP2) has been shown to be involved in intracellular transport and metabolism of cholesterol. However, there have been no reports concerning SCP2 in macrophages, the major source of atheromatous foam cells. We investigated whether SCP2 is present in rat peritoneal macrophages and determined the changes of SCP2 and its mRNA levels in macrophages during form cell formation induced by acetylated LDL (AcLDL). Immunoblot analysis and Northern blot analysis demonstrated that both SCP2 and its mRNA are expressed in rat peritoneal macrophages. Incubations with AcLDL caused a dose- and time-dependent increase of cellular esterified cholesterol, SCP2 and its mRNA in rat peritoneal macrophages. The inhibitor of acyl-CoA:cholesterol acyltransferase further enhanced AcLDL- induced increase of SCP2 protein and its mRNA. Incubations with 25-hydroxy cholesterol also caused a dose-dependent stimulation of SCP2 gene expression in macrophages, while incubation with maleylated BSA had no effect. These results suggest that the increment of cellular-free cholesterol is responsible for enhanced SCP2 gene expression in macrophages. The enhancement of SCP2 gene expression by AcLDL suggests that SCP2 may play an important role during foam cell formation induced by AcLDL which may be most important step for the atherosclerosis. Find the latest version: https://jci.me/117583/pdf Regulation of Sterol Carrier Protein 2 (SCP2) Gene Expression in Rat Peritoneal Macrophages during Foam Cell Formation A Key Role for Free Cholesterol Content Aizan Hirai, Tomoshige Kino, Koutarou Tokinaga, Kazuo Tahara, Yasushi Tamura, and Sho Yoshida The Second Department of Internal Medicine, Chiba University Medical School, 1-8-1, Inohana, Chyuouku, Chiba 260 Japan Abstract modified LDL such as acetylated LDL (AcLDL)' via the scav- enger receptors (3). In the macrophages, modified LDL is hy- Sterol carrier protein 2 (SCP2) has been shown to be in- drolyzed in lysosomes, and much of the liberated cholesterol volved in intracellular transport and metabolism of choles- is transported to the endoplasmic reticulum for the formation terol. However, there have been no reports concerning SCP2 of cholesteryl esters by acyl-CoA:cholesterol acyltransferase in macrophages, the major source of atheromatous foam (ACAT) (4). ACAT-catalyzed esterification of cholesterol is cells. We investigated whether SCP2 is present in rat perito- markedly accelerated by the liberated cholesterol in the macro- neal macrophages and determined the changes of SCP2 and phages uptaking AcLDL, resulting in the accumulation of large its mRNA levels in macrophages during foam cell formation amount of cholesteryl esters within the cells (5). induced by acetylated LDL (AcLDL). Since cholesterol is relatively water insoluble, transfer pro- Immunoblot analysis and Northern blot analysis demon- teins which can facilitate cytoplasmic cholesterol transport and strated that both SCP2 and its mRNA are expressed in rat affect distribution of cholesterol in cell organelles could be of peritoneal macrophages. Incubations with AcLDL caused importance in the regulation of intracellular cholesterol metabo- a dose- and time-dependent increase of cellular esterified lism (6). In contrast to the vast amount of information available cholesterol, SCP2 and its mRNA in rat peritoneal macro- on the identification of lipoproteins and receptors that may be phages. The inhibitor of acyl-CoA:cholesterol acyltransfer- involved in foam cell formation, very little is known about the ase further enhanced AcLDL-induced increase of SCP2 pro- regulation of pathways that govern intracellular trafficking of tein and its mRNA. Incubations with 25-hydroxy cholesterol cholesterol in macrophage foam cells. Recent studies have sug- also caused a dose-dependent stimulation of SCP2 gene ex- gested that this sterol translocation may be mediated by specific pression in macrophages, while incubation with maleylated sterol transfer proteins. Sterol carrier protein 2 (SCP2), also BSA had no effect. These results suggest that the increment called nonspecific lipid transfer protein (7), is a low molecular of cellular-free cholesterol is responsible for enhanced SCP2 weight protein (13.2 kD) and thought to be one of highly touted gene expression in macrophages. The enhancement of SCP2 candidates for an intracellular cholesterol carrier (6-8). SCP2 gene expression by AcLDL suggests that SCP2 may play an has been reported to facilitate enzymatic reactions involved in important role during foam cell formation induced by cholesterol biosynthesis in the liver (6), and in ACAT-catalyzed AcLDL which may be most important step for the athero- cholesterol esterification in various tissues such as the liver, sclerosis. (J. Clin. Invest. 1994. 94:2215-2223.) Key words: intestine, adrenal cortex, and aorta (9-11). On the other hand, macrophage * sterol carrier protein 2 * acetylated LDL - no relationship between SCP2 level and ACAT-dependent cho- oxysterol * foam cell lesterol esterification in vivo has been shown in the experiments using SCP2-deficient cells (12, 13). The protein has also been reported to participate in mitochondrial production of steroids Introduction from cholesterol in the adrenal cortex (14, 15). Recently, SCP2 is reported to exhibit a tissue-specific distribution and expression, One of the major histological characteristics of atherosclerosis which is closely correlated with the rate of cholesterol metabo- is the accumulation of large amounts of lipids, especially lism in each tissues (16). cholesteryl esters, in the arterial wall (1). In the atherosclerotic These evidences suggest that SCP2 might play a certain role plaques, macrophages are thought be the major source of athero- for the esterification of cholesterol during the formation of foam matous foam cells (2). Since they are reported to uptake the cell from the macrophages by AcLDL, which is one of the most important steps in the atherosclerosis. However, there have been no reports concerning not only the existence of SCP2, but also This paper was presented in part at the Third Saratoga International the changes of SCP2 during foam cell formation in macrophages. Conference on Atherosclerosis and published in abstract form (Athero- The present investigation was performed in order to explore sclerosis III. Ann. NY Acad. Sci. In press). a new insight into the regulation of intracellular cholesterol Address correspondence to Aizan Hirai, M.D., The Second Depart- metabolism by lipid transfer protein during foam cell formation. ment of Internal Medicine, Chiba University Medical School, 1-8-1, Inohana, Chyuouku, Chiba 260 Japan. Receivedfor publication 10 May 1994 and in revisedform 2 August 1994. 1. Abbreviations used in this paper: 25-OH cholesterol, 25-hydroxy cholesterol; ACAT, acyl-CoA:cholesterol acyltransferase; AcLDL, J. Clin. Invest. acetylated LDL; Apo E, apoprotein E; EIA, enzyme immunoassay; X The American Society for Clinical Investigation, Inc. HMG-CoA, 3-hydroxy-3-methylglutaryl CoA; Mal-BSA, maleylated 0021-9738/94/12/2215/09 $2.00 BSA; p-APMSF, p-amidinophenyl methanesulfonyl fluoride hydrochlo- Volume 94, December 1994, 2215-2223 ride; SCP2, sterol carrier protein 2. Regulation of Sterol Carrier Protein 2 Gene Expression during Foam Cell Formation 2215 For this purpose, we studied the following questions: (a) Is pore size). The membranes were subjected to treatment with anti-SCP2 SCP2 present in rat peritoneal macrophages from the view of IgG and secondary, [1251] anti-rabbit Ig F(ab')2 fragment from donkey. both protein and mRNA? (b) Are SCP2 and its mRNA regulated Then the membranes were exposed to x-ray film at -80°C with an by uptake of AcLDL in macrophages? intensifying screens for 48 h. Preparation of rat SCP2 cDNA probe. cDNA was prepared from rat liver poly(A)+ RNA using a cDNA Synthesis Kit. A rat SCP2 cDNA Methods fragment was obtained using PCR (21). Rat liver cDNA was used as template, and the following oligonucleotides were used as primers: Preparation of SCP2 from rat liver and anti-SCP2 IgG. SCP2 was puri- CACGAATTCGGAAAGTGGGTCATAAACCCTAG and CTCGAA- fied -5,000-fold to homogeneity from 105,000 g supernatant of rat liver TTCTCATCTTGATGTCCTGAGG. Isolation and sequencing of posi- using a two-step fast flow ion-exchange and gel permeation column tive clones were with standard methods (22, 23). The positive clone chromatography as reported previously (17). SCP2 activity was deter- (664 bp) coded the 502-1165 nucleotide segment of rat SCP2 cDNA mined by the stimulation of microsomal conversion of 7-dehydro- reported by Billheimar et al. (24) and contained the full-length coding cholesterol to cholesterol according to the method of Noland et al. (6). region for the rat SCP2 and had the sequence reported (25). The purified SCP2 was used as antigen for the immunization of a rabbit mRNA extraction and hybridization. Total RNA was isolated from according to a previously reported method (11). IgG fraction was pre- rat peritoneal macrophages and rat liver according to the method of pared from the antiserum using Protein G-Sepharose 4 FF column. Auffray and Rougen (26). mRNA was purified from total RNA using Specific antibody against SCP2 was prepared from the IgG fraction