Rev Soc Bras Med Trop 51(2):190-197, March-April, 2018 doi: 10.1590/0037-8682-0088-2017 Major Article Natural infection by Trypanosoma cruzi in triatomines and seropositivity for Chagas disease of dogs in rural areas of Rio Grande do Norte, Brazil Yannara Barbosa Nogueira Freitas[1], Celeste da Silva Freitas de Souza[2], Jamille Maia e Magalhães[1], Maressa Laíse Reginaldo de Sousa[1], Luiz Ney d’Escoffier[2], Tânia Zaverucha do Valle[2], Teresa Cristina Monte Gonçalves[3], Hélcio Reinaldo Gil-Santana[4], Thais Aaparecida Kazimoto[1] and Sthenia Santos Albano Amora[1] [1]. Centro de Ciências Agrárias, Universidade Federal Rural do Semi-Árido, Mossoró, RN, Brasil. [2]. Laboratório de Imunomodulação e Protozoologia, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil. [3]. Laboratório Interdisciplinar de Vigilância Entomológica em Diptera e Hemiptera, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil. [4]. Laboratório de Diptera, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil. Abstract Introduction: Chagas disease is caused by the protozoa Trypanosoma cruzi. Its main reservoir is the domestic dog, especially in rural areas with favorable characteristics for vector establishment and proliferation. The aims of this study were to collect data, survey and map the fauna, and identify T. cruzi infection in triatomines, as well as to assess the presence of anti-T. cruzi antibodies in dogs in rural areas of the municipality of Mossoró, Brazil. Methods: An active entomologic research was conducted to identify adult specimens through an external morphology dichotomous key. The analysis of natural infection by T. cruzi in the insects was performed by isolation in culture and polymerase chain reaction. The antibody testing for T. cruzi in dogs was performed by enzyme-linked immunosorbent assay and indirect immunofluorescence assay.Results: A total of 68 triatomines were captured, predominantly the Triatoma brasiliensis brasiliensis (Neiva 1911) species. The vector mapping displayed areas with greater risk for parasite transmission. Of the examined triatomines (51 specimens), 41.2% (21/51) were positive on polymerase chain reaction, and all were negative on culture. In the serum testing, 11% (25/218) of dogs were seropositive, but no association was found between the serologic results and the presence and infection by T. cruzi in triatomines. Conclusions: This study demonstrated the movement of T. cruzi in the studied area, by the presence of vectors and naturally infected domestic reservoirs. The mapping of the studied rural area demonstrates the risk of disease transmission. Keywords: Chagas disease. Vector. Domestic reservoir. Diagnosis. Zoonosis. INTRODUCTION of insect vectors and wild animals that then enter homes for shelter and food5,6. Chagas disease (CD) is an anthropozoonosis caused by the protozoan Trypanosoma cruzi and is typically transmitted Domestic animals, especially dogs, have an important by triatomines, vectors of the Triatominae family (Hemiptera: epidemiological role, because they serve as a link between 7,8 Reduviidae), known as kissing bugs1-3. domestic and wild cycles of T. cruzi . Furthermore, they are an important disease sentinel, as their infection rates may reveal In Brazil, the triatomine species responsible for CD the potential of disease transmission to humans9-12. transmission show wide spatial distribution and invasive potential, by adapting to homes and surrounding areas4. Vector However, for a better comprehension of the epidemiology presence can also be facilitated by constant alterations to the of CD, the whole cycle, including vectors, must be assessed. natural environment, caused by anthropic activities, leading Therefore, identifying the vector species and infection type to imbalances in ecosystems and modification of the behavior is crucial to understanding the biology and behavior and to evaluating the risk of disease transmission to humans and domestic animals4,13. An important tool used in epidemiological studies of vector-borne diseases is the mapping of the vector’s Corresponding author: Dra. Sthenia Santos Albano Amora. spatial distribution, allowing for the prediction of T. cruzi e-mail: [email protected] transmissibility between triatomine species from spatial data14. Received 20 July 2017 Accepted 18 April 2018 190 Freitas YBN et al. – T. cruzi infection in vectors and dogs Thus, this study aimed to gather data on animals in a rural chain reaction (PCR) techniques in the Laboratory of area of Northeastern Brazil, as well as to map and investigate Immunomodulation and Protozoology of FIOCRUZ/RJ. natural infection by T. cruzi in triatomines. The study also aimed For the isolation, the obtained contents were seeded in tubes to detect the presence of anti-T. cruzi antibodies in dogs in order containing biphasic Novy-MacNeal-Nicolle + Liver Infusion to evaluate a possible association between infected dogs and the Tryptose culture medium, supplemented with 10% fetal bovine presence of triatomines infected by T. cruzi. and to determine serum and penicillin (10,000U/mL). The tubes were kept in an environment-related factors. incubator (FANEM, model 347) at 27°C, and the cultures were examined weekly for four months by light microscopy using METHODS an Axioplan 2 (Zeiss®) light microscope to verify positivity. Study area and sample definition To detect T. cruzi deoxyribonucleic acid (DNA), phenol- chloroform extraction was used to obtain DNA16, which The research was conducted in the rural area of Mossoró, was then subjected to a PCR with specific primers for located in the countryside of Rio Grande do Norte, Northeast T. cruzi (5’ ASTCGGCTGATCGTTTTCGA 3’ and 5’ region of Brazil. According to the State Department of Public AATTCCTCCAAGCAGCGGATA 3’)17. The reaction was Health, this area is considered endemic, because it presents performed in a Step One Plus™ Real-Time PCR System, using a favorable environment for the vector’s survival, due to the a rapid protocol of 20 seconds at 95°C followed by 40 cycles proximity of forests and a city dump, as well as an accumulation of 3 seconds at 95°C and 30 seconds at 60°C. Ultrapure water of debris and organic matter from animal husbandry. A total of was used as the negative control, and DNA obtained from 11 rural areas with environmental indicators for the occurrence axenic culture of the T. cruzi strain Y was used as the positive of triatomines and a history of vector capture between 2008 control. The amplified products were subjected to agarose gel and 2012, according to the Municipal Health Surveillance electrophoresis at 1.5% and stained with GelRed™ (Biotium), Department, were used in this study. using TBE 1x buffer as an electric conductor. Ethical considerations Anti-T. cruzi antibody evaluation in domestic dogs All of the 392 residences in these areas were visited between Blood samples from 218 domestic dogs were collected March and July 2014, and informed consent forms were obtained and, after centrifugation, the serum samples were stored from residents that agreed to participate. in tubes and packed at -20°C until the performance of the The project was approved by the Ethics Committee on enzyme-linked immunosorbent assays (ELISA) and indirect Animal Use of the Federal Rural University of the Semi-Arid immunofluorescence assays (IIF) at the Laboratory of (Universidade Federal Rural do Semi-Árido) (Ruling 62/2012 Immunomodulation and Protozoology of FIOCRUZ/RJ. - Process 23091.002190/2012-75). For the anti-T. cruzi immunoglobulin G (IgG) antibody assay Active entomologic collection by IIF, immunofluorescent microscope slides with totalT. cruzi antigen were produced in the Laboratory of Trypanosomatid The entomological collection consisted of a system of Biology of FIOCRUZ/RJ. Previously tested positive canine notification and collection by the residents of triatomines in serum and serum of dogs from non-endemic areas were used their homes. Therefore, this method allowed for the monitoring as positive and negative controls, respectively18. An anti-dog of infestations by the local community. IgG (FITC, Sigma™) was used as the conjugate. Serums with Samples of different species of triatomines were presented titration ≤1:20 were considered positive19. to the residents to facilitate the recognition and capture of the A commercial kit produced by Bio-Manguinhos/FIOCRUZ insects, and they were given a polyethylene bottle containing and the anti-dog IgG conjugate (Peroxidase, Sigma™) were holes in the lid to store the insects. After capture, the insects used for the ELISA. Samples were considered seropositive were sent to the Oswaldo Cruz Foundation Institute in Rio de when they showed an optical density (OD) greater than the cut Janeiro (FIOCRUZ-RJ), in a specific shipment for biological line (cut-off) obtained in each reaction. samples with a deadline of 24 hours, paid for by the institute. As recommended by the World Health Organization for the Upon receipt, the samples were immediately processed. diagnosis of human CD, samples were only considered positive Vector identification when they reacted in both serological tests. Properly packed triatomines were sent to the Laboratory of Data analysis Leishmaniosis Transmitters of the Forensic Entomology Sector The data for the statistical analysis were obtained from the of the FIOCRUZ/RJ and identified by observing their external identification form of the dogs, the serology results of the dogs’ morphological characters, using the dichotomous key according blood samples, and