CELLULOSE CHEMISTRY AND TECHNOLOGY PRODUCTION AND CHARACTERIZATION OF BACTERIAL CELLULOSE FROM KOMAGATAEIBACTER XYLINUS ISOLATED FROM HOME-MADE TURKISH WINE VINEGAR BURAK TOP,* ERDAL UGUZDOGAN,** NAZIME MERCAN DOGAN,* SEVKI ARSLAN,* NAIME NUR BOZBEYOGLU *** and BUKET KABALAY * *Department of Biology, Faculty of Arts and Science, Pamukkale University, 20070, Denızlı̇ ̇, Turkey ** Department of Chemical Engineering, Faculty of Engineering, Pamukkale University, 20070, Denizli, Turkey *** Plant and Animal Production Department, Tavas Vocational High School, 20500, Denizli, Turkey ✉Corresponding author: Naime Nur Bozbeyoglu, [email protected] Received February 23, 2021 In this research, bacterial cellulose (BC) was produced from Komagataeibacter xylinus S4 isolated from home-made wine vinegar (Denizli-Çal) and characterized through morphological and biochemical analyses. K. xylinus was identified by 16S rDNA sequence analysis. The wet (51.8-52.8 g) and dry (0.43-0.735 g) weights of the produced BC were measured. The morphology of cellulose pellicles was examined by scanning electron microscopy (SEM) and a dense nanofiber network was observed. TGA analysis showed that the weight loss in the dehydration step in the BC samples occurred between 50 °C and 150 °C, while the decomposition step took place between 215 °C and 228 °C. Also, the cytotoxic effect, moisture content, water retention capacity and swelling behavior of BC were evaluated. In vitro assays demonstrated that BC had no significant cytotoxic effect. It was found that BC had antibacterial and antibiofilm potential (antibacterial effect>antibiofilm effect). All the results clearly showed that the produced BC can be considered as a safe material for different purposes, such as wound dressings. Key words : Komagataeibacter xylinus , bacterial cellulose, antibiofilm, cytotoxic activity, SEM, FTIR, TGA INTRODUCTION Microorganisms secrete a wide range of Salmonella .1-6 In recent years, there has been an polymers, which have potential for use in increasing interest in bacterial cellulose as an different areas of the industry. Due to their important alternative to plant cellulose, due to its complex physical and chemical structure, as well physical and chemical properties. BC has a high as biological properties, these biopolymers have degree of purity and polymerization. In addition, economic and ecological value. Cellulose is one its crystallization index is higher than that of plant of the bacterial products and the most common cellulose. Moreover, its high tensile strength and biopolymer on earth. Bacterial cellulose is an high water holding capacity also provide potential extracellular polymer, which is the first product of for use in the paper and food industries. cell metabolism and acts as a preservative. On the Moreover, it has potential applications in various other hand, plant cellulose acts as a component of industries, such as nano-paper, textiles, medicine, the cell. Plants are the largest source of cellulose food, tissue engineering and nanotechnology.7-12 in the world, but the world’s resources are In large-scale BC production, the cost limited. Therefore, using microorganisms as an effectiveness is mainly dependent on the alternative to plants for cellulose production is modification of known strains, finding novel important. producer strains or improving the BC production Bacterial cellulose (BC) is an conditions. Therefore, the cellulose production exopolysaccharide produced by various bacteria, conditions of bacteria must be optimized or new such as Acetobacter , Gluconacetobacter , bacteria that can produce high amounts of Agrobacterium , Rhizobium , Cyanobacteria and cellulose should be screened. In the literature, Cellulose Chem. Technol., 55 (3-4), 243-254(2021) BURAK TOP et al . many researchers have investigated the effects of novel isolated strains, different media, carbon and Bacterial cellulose production , culture conditions nitrogen sources, culture conditions, static and and bleaching of cellulose agitated incubation on the production of bacterial The S4 strain was incubated at 30 °C for 4-14 days cellulose.2,13-17 in HS medium. At the end of the incubation period, the BC formed on the surface of the medium was gently In the present study, we aimed to determine taken and kept in 0.1 M NaOH at 80 °C for 1 h. After the ability of BC production of a local isolate the BC was washed with dH 2O until the BC reached Komagataeibacter xylinus S4 strain in HS- neutral pH,21 it was lyophilized and stored at -20 °C for modified with various carbon sources, such as analyses. glucose, mannitol, sucrose, arabinose and lactose. Also, the obtained BC was characterized by FTIR, Water absorption SEM and thermal analysis, as well as in terms of The water absorption capacity of the BC sample 22 its water holding capacity, antimicrobial and was determined by the method described by Lin et al . cytotoxic activities. with slight modifications. Briefly, lyophilized and dried BC membranes were cut into small pieces (4x4 cm) and were weighed (labelled as Wdry ). The material EXPERIMENTAL was merged into water and incubated at 25 °C for 24 h. Strain isolation of and identification Specimens were removed at certain intervals and then The strain S4 was isolated from home-made weighed (W wet ) after removing excess water. The water Turkish vinegar (Denizli-Çal, Turkey). First, the BC absorption was determined by calculating the increase membrane was washed with saline water containing in weight percent by the formula: PBS. After that, for isolation and in all manipulations, Hestrin-Schramm (HS) medium was used (g/L): Water absorption (%) = [(Wet weight of BC – Dry glucose 20; disodium hydrogen phosphate, 2.7; citric weight of BC)/Dry weight of BC]x100 (1) acid, 1.15; peptone 5; yeast extract, 5; agar, 14.18 The Similarly, the moisture content of bacterial DNA of the isolated S4 strain was isolated by using the cellulose was calculated by using the following GeneJET Genomic DNA Purification Kit (Thermo formula. Two replications were performed for this Scientific) according to the manufacturer’s procedure. experiment. The 16S rDNA gene was amplified by using the Moisture content (%) = [(W wet −Wdry )/Wwet ] ×100 (2) primers 27F (AGAGTTTGATCCTGGCTCAG), 529F (GTGCCAGCMGCCGCGG) and 1491R Water retention (ACGGCTACCTTGTTACGACTT) on a The water retention capacity of bacterial cellulose Thermalcycler (QLS Optimus 96G). The polymerase 22 was determined according to the method of Lin et al . chain reaction (PCR) mixtures consisted of 15 µl 2X The lyophilized and dried bacterial cellulose Amp Master Taq (GeneAll), 2 µl for reverse and membranes were weighed to determine their initial dry forward primers, 5 µl DNA template and 6 µl PCR weight (W ). Then, these materials were soaked into grade H O. The PCR products were checked by using dry 2 deionized water for 24 h. After this duration, the 1% agarose gel electrophoresis. The PCR products membranes were taken out from water and excess were isolated from the gel and sequenced. The water was removed by using filter paper. The weights bacterial strain was identified by 16S rDNA analysis of the samples placed on an open plate were measured (Triogen Biotechnology, Istanbul, Turkey). at certain time periods (W ). The percent water wet retention of BC was calculated by using the following Biochemical and physiological tests formula. Two replications were performed for this For the phenotypic and chemotaxonomic experiment. characterization of the S4 strain, morphological, physiological and biochemical tests were carried out Water retention (%) = [(W wet −Wdry )/Wdry ] ×100 (3) (Table 1). The acetic acid production of the S4 strain was confirmed by Carr medium (g/L: yeast extract, 30; Cell culture and cytotoxicity assay Bromocresol Purple, 0.022; agar, 20; ethyl alcohol 20 Human embryonic kidney 293 cells line (HEK293) mL/L) and Frateur medium (g/L: glucose, 0.5; were obtained from the European Collection of Cell peptone, 3; yeast extract, 5; calcium carbonate, 15; Cultures (ECACC, UK). Cells were cultured in agar, 12; ethyl alcohol, 15 mL/L).19 In order to observe DMEM, including 10% FBS and 1% the cellulose production activity of the S4 strain on the penicillin/streptomycin mixture, in a humidified atmosphere (95% air with 5% CO 2) at 37 °C. HEK293 solid medium, a fluorescent brightener 28 (FB28, 3 Calcofluor White), with non-specific fluorochrome cells were grown in 96-well plates at a density of 1x10 binding to cellulose, was added at 0.2 g/L in HS cells/mL culture medium. After 24 h of growth, the medium and the colonies on the surface of the agar medium was removed, and cells were treated with medium were examined under UV.20 extracted bacterial cellulose. The extraction was performed as described in Lin et al .22 with slight 244 Bacterial cellulose modifications. Briefly, 2x2 cm cut bacterial cellulose accessory unit, in the region from 400 to 4000 cm -1 at was extracted at 37 °C for 24 h in culture media in a the ambient temperature. shaker. After 24 h, the medium was removed and filtered. An equal amount of medium without extract Thermogravimetric analysis was added to untreated cells (control). Cellulose Thermal decomposition behaviors of the samples treated and control cells were incubated for 48 h. were carried out with Perkin-Elmer Diamond Following incubation, medium containing floating thermogravimetric analysis (TG/DTG) device. About 5 cells were removed, and attached cells were treated mg of a sample was placed in a ceramic pan and heated with crystal violet [0.5% (w/v) in 10% ethyl alcohol]. at 10 °C/min from 50 °C to 600 °C under N 2 The dye absorbed by live cells was solubilized with atmosphere (200 mL/min). Differential scanning sodium citrate (0.1 M in 50% ethyl alcohol). Colour calorimetry (DSC) analyses of the samples were intensity was determined at 630 nm. Three replicated performed using a Perkin-Elmer Pyris 6 DSC wells were used for each experimental condition. instrument. The sample was put in an aluminum pan Viability was expressed as a percentage of the control.