Research Article Identification of an ABCB1 (P-glycoprotein)-positive carfilzomib-resistant myeloma subpopulation by the pluripotent stem cell fluorescent dye CDy1 Teresa S. Hawley,1 Irene Riz,2 Wenjing Yang,3 Yoshiyuki Wakabayashi,4 Louis DePalma,2,5 Young-Tae Chang,6,7 Weiqun Peng,2,3 Jun Zhu,4 and Robert G. Hawley2,8* Multiple myeloma (MM) is characterized by the malignant expansion of differentiated plasma cells. Although many chemotherapeutic agents display cytotoxic activity toward MM cells, patients inevitably succumb to their disease because the tumor cells become resistant to the anticancer drugs. The cancer stem cell hypothesis postulates that a small subpopulation of chemotherapy-resistant cancer cells is responsible for propagation of the tumor. Herein we report that efflux of the pluripotent stem cell dye CDy1 identifies a subpopulation in MM cell lines characterized by increased expression of P-glycoprotein, a member of the ABC (ATP-binding cas- sette) superfamily of transporters encoded by ABCB1. We also demonstrate that ABCB1-overexpressing MM cells are resistant to the second-generation proteasome inhibitor carfilzomib that recently received accelerated approval for the treatment of therapy-refractive MM by the U.S. Food and Drug Administration. Moreover, increased resistance to carfilzomib in sensitive MM cells following drug selection was associated with upregu- lation of ABCB1 cell-surface expression which correlated with increased transporter activity as measured by CDy1 efflux. We further show that chemosensitization of MM cells to carfilzomib could be achieved in vitro by cotreatment with vismodegib, a hedgehog pathway antagonist which is currently in MM clinical trials. CDy1 efflux may therefore be a useful assay to determine whether high expression of ABCB1 is predictive of poor clinical responses in MM patients treated with carfilzomib. Our data also suggest that inclusion of vismodegib might be a potential strategy to reverse ABCB1-mediated drug resistance should it occur. Am. J. Hematol. 88:265–272, 2013. VC 2013 Wiley Periodicals, Inc. Introduction MM pathogenesis [17], we set out to investigate the existence Multiple myeloma (MM), an incurable clonal plasma cell disor- and properties of a CDy1-positive subpopulation in MM. der, is the second most common hematologic malignancy in the Materials and Methods United States with over 20,000 new cases and 10,000 deaths each year. Although patients initially respond to therapy, they Cell lines and reagents eventually relapse because the MM cells acquire drug resist- The NCI-H929 and RPMI-8226 cell lines were obtained from the ance [1]. The cancer stem cell (CSC) hypothesis predicts that a American Type Culture Collection (Manassas, VA). KMS-5 cells were a kind gift from Dr. Michio Kawano (Yamaguchi University, Yamaguchi, small subpopulation of cancer cells is responsible for tumor propagation [2]. Demonstration of a low percentage of clono- Additional Supporting Information may be found in the online version of this genic cells in the bulk tumor first prompted a search for CSCs in article. MM over 30 years ago [3]. By analogy to normal stem cells, 1 Flow Cytometry Core Facility, The George Washington University, Washing- CSCs are predicted to be drug-resistant due to expression of ton, DC; 2Department of Anatomy and Regenerative Biology, The George enzymes that detoxify chemotherapeutic agents (such as alde- Washington University, Washington, DC; 3Department of Physics, The George hyde dehydrogenase (ALDH) which neutralizes cyclophospha- Washington University, Washington, DC; 4Genetics and Developmental Biol- mide) or members of the ATP-binding cassette (ABC) family of ogy Center, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD; 5Department of Pathology, The George Washington transporters that efflux them out of the cells [4–7]. Despite these University, Washington, DC; 6Department of Chemistry and MedChem Pro- similarities, the relationship between drug-resistant MM cells at gram, Life Sciences Institute, National University of Singapore, Singapore; 7Laboratory of Bioimaging Probe Development, Singapore Bioimaging Con- relapse and putative MM CSCs remains unclear, and the clinical 8 relevance of CSCs in MM remains a matter of much debate [8]. sortium, Agency for Science, Technology and Research, Singapore; Sino-US Joint Laboratory of Translational Medicine, Jining Medical University Affiliated For example, efflux of the vital dye Hoechst 33342 by the ABC Hospital, Jining Medical University, Jining, Shandong, China family members ABCB1 or ABCG2 identifies a subpopulation of Conflict of interest: Nothing to report cells—termed “side population” (SP)—that exhibits stem cell- T.S.H. and I.R. contributed equally to this work. like properties in a variety of normal and malignant tissues [9,10]. However, variable results have been obtained regarding *Correspondence to: R. G. Hawley, Department of Anatomy and Regenerative Biology, The George Washington University, 2300 I Street NW, Washington, the CSC-like SP phenotype in human MM cell lines and patient DC 20037. E-mail: [email protected] samples. Using this assay, Matsui’s group identified a clono- Contract grant sponsor: The Dr. Cyrus and Myrtle Katzen Cancer Research genic CD138-negative subpopulation that was resistant to lena- Center at the George Washington University (to R.G.H.) and Pilot Project lidomide whereas Jakubikova et al. characterized a clonogenic Award from the Clinical and Translational Science Institute at Children’s SP subpopulation that primarily expressed CD138 and was sen- National Medical Center NIH; Contract grant number: UL1RR031988 (to I.R.); Contract grant sponsor: NIH; Contract grant numbers: R01HL65519; sitive to lenalidomide [11,12]. R01HL66305 (to R.G.H.). Chang et al. recently reported the synthesis of a vital dye Received for publication 10 December 2012; Revised 21 December 2012; CDy1 that distinguishes embryonic stem cells and induced plu- Accepted 31 December 2012 ripotent stem cells [13,14]. Because a MYC-centered tran- Am. J. Hematol. 88:265–272, 2013. scriptional network has been associated with an embryonic Published online 22 January 2013 in Wiley Online Library stem cell gene expression signature in other cancers [15,16], (wileyonlinelibrary.com). and activation of this proto-oncogene is a recurring event in DOI: 10.1002/joh.23387 VC 2013 Wiley Periodicals, Inc. American Journal of Hematology 265 http://wileyonlinelibrary.com/cgi-bin/jhome/35105 research article Japan) [18,19]. The doxorubicin-resistant RPMI-8226/Dox40 cell line was GTAGCA; KIF14, forward, TGGTGATGACCCAGACCAAGACAG, reverse, kindly provided by Dr. William Dalton (Moffitt Cancer Center, Tampa, FL) GCGCTCACTGCCTGCCAGAT; NUCB2, forward, CAGGTTTGTGCGCTG [20]. KMS-34 cells were a kind gift from Dr. P. Leif Bergsagel (Mayo GACGC, reverse, CGTAACACGTTCTGGCCGGGT; SS18, forward, AGCA Clinic, Scottsdale, AZ) [21]. Cells were cultured in RPMI 1640 (Medi- GCAGGGCTACGGTCCT, reverse, TGGCTGTGGTGGTCCAGGCT; TMPO, atech, Manassas, VA) supplemented with 10% fetal bovine serum (Cam- forward, ACCCAGAAGAGCACCAAAGAAACCA, reverse, TGGTCTGCGGC brex BioScience, Walkersville, MD), 100 U/mL penicillin, 100 lg/mL AACTAGCACTAA; and VAPA, forward, CACAGACCTCAAATTCAAAGGCC streptomycin and 2 mM L-glutamine. Carfilzomib was obtained from CC, reverse, GGCCTCACACAGTACCGGCG. Active Biochem (Maplewood, NJ), vismodegib was from Selleck Chemi- Gene expression data were obtained for biological replicates and pre- cals (Houston, TX) and reversin 121 was from Santa Cruz Biotechnology sented as the mean6SD. qRT-PCR controls, which included ACTB, (Santa Cruz, CA). Rhodamine 123 and SYTOX Red were purchased GAPDH, PGK1, RPL13A, and TBP, were confirmed not to show any from Life Technologies (Grand Island, NY), the Aldefluor reagent was changes in expression under the experimental conditions studied. Pri- purchased from StemCell Technologies (Vancouver, BC) and other mers: ACTB, forward, GGACTTCGAGCAAGAGATGG, reverse, AGCA chemicals were purchased from Sigma-Aldrich (St. Louis, MO). CTGTGTTGGCGTACAG; GAPDH, forward, GAGTCAACGGATTTGG Fluorescence-activated cell sorting and analysis TCGT, reverse, TTGATTTTGGAGGGATCTCG; PGK1, forward, CTGT MM cells were stained with CDy1 as previously described [13,14]. GGGGGTATTTGAATGG, reverse, CTTCCAGGAGCTCCAAACTG; RPL13A, Briefly, cells were incubated in growth medium containing 500 nM CDy1 forward, CCTGGAGGAGAAGAGGAAAGAGA, reverse, TTGAGGACCT at 2 3 105 cells/ml. After 1 hr at 37C, cells were centrifuged and CTGTGTATTTGTCAA; and TBP, forward, TATAATCCCAAGCGGTTTGC, washed twice in growth medium. Stained cells were allowed to efflux in reverse, GCTGGAAAACCCAACTTCTG. The data were normalized to growth medium for 3 hrs at 37C unless otherwise indicated. Fluores- GAPDH expression levels. cence-activated cell sorting (FACS) was performed on a FACSAria Viability assays instrument equipped with FACSDiva software (BD Biosciences; San Cell growth was measured using the alamarBlue cell viability and pro- Jose, CA) [10,22]. Experiments that did not require cell sorting were per- liferation reagent (Life Technologies) as previously described [29]. Where formed on an upgraded digital 3-laser, 8-parameter FACSCalibur DxP8 indicated, cells were treated with carfilzomib, CoCl2, 2-methoxyestradiol, instrument equipped with FlowJo Collector’s Edition software (Cytek De- reversin 121, verapamil, or vismodegib at the indicated concentrations. velopment; Freemont, CA). Data were analyzed with