Theor Appl Genet (2002) 104:482–489 © Springer-Verlag 2002 R. Cronn · M. Cedroni · T. Haselkorn · C. Grover J.F. Wendel PCR-mediated recombination in amplification products derived from polyploid cotton Received: 28 February 2001 / Accepted: 8 June 2001 Abstract PCR recombination describes a process of in Introduction vitro chimera formation from non-identical templates. The key requirement of this process is the inclusion of PCR recombination describes the process of in vitro chi- two partially homologous templates in one reaction, a mera formation between amplification products from condition met when amplifying any locus from polyploid two or more templates. This process requires that a mini- organisms and members of multigene families from dip- mum of two highly similar, non-identical target sequenc- loid organisms. Because polyploids possess two or more es be present in a single PCR amplification reaction, a divergent genomes (“homoeologues”) in a common nu- condition met by heterozygosity at a single locus or by cleus, intergenic chimeras can form during the PCR am- genic redundancy. The presence of chimeric molecules plification of any gene. Here we report a high frequency primarily has been attributed to the periodic formation of of PCR-induced recombination for four low-copy genes incompletely extended PCR products (Saiki et al. 1988; from allotetraploid cotton (Gossypium hirsutum). Ampli- Myerhans et al. 1990; Shammas et al. 2001). In the pres- fication products from these genes (Myb3, Myb5, G1262 ence of two similar templates, prematurely terminated and CesA1) range in length from 860 to 4,050 bp. Inter- products can anneal to non-identical templates and be genomic recombinants were formed frequently, account- extended to completion in the next cycle. The resulting ing for 23 of the 74 (31.1%) amplicons evaluated, with recombinant molecules are propagated during subse- the frequency of recombination in individual reactions quent rounds of PCR, where they are subject to addition- ranging from 0% to approximately 89%. Inspection of al rounds of recombination. In vitro recombination can the putative recombination zones failed to reveal se- also occur via polymerase template switching in the quence-specific attributes that promote recombination. absence of temperature cycling (Odelberg et al. 1995; The high levels of observed in vitro recombination indi- Shammas et al. 2001). While PCR recombination has cate that the tacit assumption of exclusive amplification been most frequently evaluated using experimental tem- of target templates may often be violated, particularly plates (Judo et al. 1998; Myerhans et al. 1990; Odelberg from polyploid genomes. This conclusion has profound et al. 1995; Yang et al. 1996; Shammas et al. 2001), the implications for population and evolutionary genetic process also has been demonstrated for natural tem- studies, where unrecognized artifactually recombinant plates, such as heterozygous Adh loci from pocket molecules may bias results or alter interpretations. gophers (Bradley and Hillis 1997) and non-homologous polyadenylated transcripts amplified via RT-PCR Keywords Cotton · Gossypium · Polyploidy · (Zaphiropoulos 1998). Chimera formation appears to be WA Sequencing · Phylogeny minimally influenced by polymerase choice, as the Kle- now fragment of Escherichia coli polI, Taq, and proof- reading polymerases such as Vent (Bradley and Hillis 1997; Judo et al. 1998) reportedly yield chimeric prod- ucts. While large PCR products appear especially prone Communicated by J. Dvorak to PCR recombination, targets as small as 242 bp (a par- tial tat sequence from HIV-1; Yang et al. 1996) demon- R. Cronn · M. Cedroni · T. Haselkorn · C. Grover strate PCR recombination frequencies of 5% or more. J.F. Wendel (✉) In light of the propensity of PCR to generate chimeras Department of Botany, Iowa State University, Ames, IA 50011-1024, USA when presented to two related templates, it seems likely e-mail: [email protected] that PCR recombination could be a frequent outcome of Tel.: +1-515-294-7172, Fax: +1-515-294-1337 amplification from complex eukaryotic genomes, given 483 their typically high levels of genic redundancy. The prob- lem might be especially acute in polyploids, where two or more genomes (“homoeologues”) are united in a single nucleus, thereby generating instantaneous doubling of all genes (Soltis and Soltis 2000; Wendel 2000). PCR ampli- fication of low-copy genes from allopolyploid genomes typically results in the amplification of both homoeolog- ous copies (Cronn and Wendel 1998; Small et al. 1998, 1999; Small and Wendel 2000; Liu et al. 2001). This com- monly observed lack of amplification specificity is due to the limited nucleotide divergence characteristic of @ 94°C @ 60°C, –0.6°C/cycle @ 72°C @ 94°C @ 54°C homoeologous loci in many allotetraploid species. For ex- @ 72°C ′ ′ ′ ′ ′ ample, pairs of low-copy genes duplicated via polyploidy ′ (“homoeologues”) in AD-genome allotetraploid cotton (Gossypiam hirsutum L.) differ by an average of about 2.2% at the nucleotide level (Cronn et al. 1999). In the course of isolating and sequencing genes impli- cated in cotton fiber development, we recently recovered amplification products that were determined by sequence analysis to be intergenic recombinants. Given the potential significance of in vitro chimera formation, we explored its extent using four different target sequences, each repre- senting low-copy genes (Myb3, Myb5, G1262 and CesA1) duplicated by relatively recent allopolyploidy (1–2 million @ 94°C 1 @ 48°C 1 @ 72°C 1 @ 94°C 1 @ 48°C 1 @ 72°C 5 ′ ′ ′ ′ ′ years ago; Wendel 1989). Because models of the diploid ′ progenitors are extant and were included in the study, the non-recombinant or “ancestral” conditions could be confi- dently determined in each case. Our results show that PCR-mediated intergenic recombination is common, with chimeras representing 23 of 74 (31.1%) of the amplicons screened, and comprising between 0% to approximately Gossypium 89% of the amplicons in individual reactions. Materials and methods @ 94°C 1 @ 48°C 1 @ 72°C 1 @ 94°C 1 @ 48°C 1 To estimate the frequency of chimera formation between homoeo- @ 72°C 1 ′ ′ ′ ′ ′ ′ logous genes, we used standard PCR conditions (Table 1) to amplify four different targets from allotetraploid (AD-genome) G. hirsutum (race Palmeri) and one locus from the related allotet- raploid Gossypium barbadense (cultivar K101 Riberalta). These included a 916-bp partial sequence from a putative P-glycoprotein gene (discovered by sequencing an anonymous PstI mapping probe, G1262; Cronn and Wendel 1998), partial sequences (Myb3: 860-bp; Myb5: 1,130-bp) from two genes encoding putative Myb transcription factors (Loguercio et al. 1999), and a 4,050-bp ge- nomic sequence of the homoeologous genes encoding cellulose synthase A1(CesA1, formerly CelA1; Pear et al. 1996). Stringent Southern-hybridization profiles for each of these genes reveal a single hybridizing locus in the diploid model progenitor species Gossypium herbaceum (A-genome) and Gossypium raimondii @ 94°C 1 @ 60°C, –0.6°C/cycle 1 @ 72°C 1 @ 94°C 1 @ 54°C 1 @ 72°C 1 ′ ′ ′ ′ ′ (D-genome); these bands are additive in the allotetraploid deriva- ′ tives G. hirsutum and G. barbadense (Cronn and Wendel 1998; G1262 Myb3 Myb5 CesA1 Cronn, Cedroni, Liu and Wendel, unpublished). Amplification primers designed for these four genes are specif- ic to their respective homoeologous targets, and they amplify iden- %A%T%C 30.1 26.8 21.7 31.7 28.3 15.9 29.4 26.0 20.6 27.5 32.0 19.5 tically sized PCR products from A- and D-genome diploid progen- itor cottons under optimized amplification conditions (Table 1). In all cases, the PCR pools from allotetraploid cottons were hetero- ) CGGAGGTCATACTTCCAGCCTY GCTACAGTTCACTATGTCGG ACGATTACGAATTCATGTGG AGCTCTGTGACACGGTGGTGYTA ) GGCGGCAGGCTAAGCACTTCY GGGCCACTAAAGAATGGAGCA GCCTCTCCGACTGTAATTAACC GATGGAATCTGGGGTTCCTGTTTGC ′ geneous, resulting from amplification of both members of the ′ –3 –3 ′ homoeologous gene pair. This was evidenced by additivity of nu- ′ cleotide polymorphisms at sites diagnostic for the orthologous se- PCR amplification and compositional properties of low-copy nuclear genes from quences from the A- and D-genome diploid species. To decom- pose this additivity, PCR products from allotetraploid cottons were Table 1 Locus F Primer (5 R primer (5 Amplicon length (bp)Nucleotide composition %G 21.2 916Initial cycles (n)Denaturation 10 1 24.1 860 10 24.1 1130 10 21.0 4050 10 Annealing 1 Extension 1 Final cycles (n)Denaturation 25 1 20 20 25 Annealing 1 Extension 1 gel-isolated, ligated into pGemT-Easy (Promega Corporation, GenBank # * AF377305-AF377315 AF377316-AF377318 * 484 Wis.) and transformed into Top10F′ E. coli cells (Stratagene, phism at position 649 was evaluated by amplifying CesA1-cloned LaJolla, Calif.) using standard heat-shock transformation proto- inserts with the CesAF primer, and a different reverse primer cols (Sambrook et al. 1989). Transformants containing cloned in- (CelAR, 5′-GGGAA CTGAT CCAAC ACCCA G-3′; Cronn et al. serts were identified by colony PCR using gene-specific primers 1999) that amplifies the 5′-most 1.1 kb of the insert. Digestion and the amplification conditions shown in Table 1. with EcoRI yields a D-genome diagnostic band 0.63-kb in length, Clones containing each gene of interest were characterized for and two A-genome diagnostic bands 0.47-kb and 0.16-kb in homoeologue identity along the entire length of the insert using ei- length. To evaluate the internal restriction-site differences revealed ther direct sequencing (Myb3, Myb5, G1262) or diagnostic restric- by HindIII and BamHI, inserts were amplified using two internal tion-site analysis (CesA1). For all genes, we initially screened primers (Ces1F3, 5′-GGATG CTTCC CAGCC CCTCT CGACT clones by sequencing the 5′ end of each insert with the “forward” A-3′; Ces1R4C, 5′-CCTCC ATTCT CCATT AGTGT AGAT-3′) gene-specific primer (Myb3F, Myb5F, G1262F, CesAF), and then that amplify the 1.9-kb region between nucleotides 911–2,818 compared sequences to those obtained from A- and D-genome of the 4.05-kb CesA1 amplicon.