European Review for Medical and Pharmacological Sciences 2019; 23: 2756-2767 SGK2 promotes renal cancer progression via enhancing ERK 1/2 and AKT phosphorylation Y. LIU1, J.-B. CHEN2, M. ZHANG1, X.-L. ZHANG3, J.-L. MENG1, J. ZHOU1, Z.-Y. HAO1, L. ZHANG1, X.-B. ZU2, C.-Z. LIANG1 1Department of Urology, the First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, China 2Department of Urology, Xiangya Hospital, Central South University, Changsha, Hunan, China 3Department of Experimental Research, Sun Yat-Sen University Cancer Center, Guangzhou, Guangdong, China Yi Liu, Jinbo Chen, and Meng Zhang contributed equally to the work Abstract. – OBJECTIVE: Increasing studies CONCLUSIONS: Our results suggested that reported that the serum- and glucocorticoid-in- SGK2 promoted RCC progression by mediat- ducible kinases (SGKs) contributed to the tum- ing the phosphorylation of extracellular regulat- origenesis of various cancer. In this article, we ed protein kinases (ERK) 1/2 and Protein kinase are aiming to explore the function of SGK2 in re- B (AKT/PKB), indicating that SGK2 might serve nal cell cancer (RCC). as a potential prognostic marker and therapeu- PATIENTS AND METHODS: In this study, tic target for renal cancer patients. the SGK2 expression was quantified by West- ern blot (WB) in multiple RCC cell lines. And Key Words in vitro SGK2 knockdown and overexpression Serum- and glucocorticoid-inducible kinases (SGKs), experiments were also performed. In addition, Renal cell cancer (RCC), Extracellular regulated protein molecular function analysis was performed us- kinases (ERK), Protein kinase B (AKT/PKB). ing FunRich software V3. The Cancer Genome Atlas (TCGA) database was retrieved to verify the association between the SGK2 expression Abbreviations and the prognosis of RCC patients. RESULTS: We found that SGK2 was up-reg- Serum- and glucocorticoid-inducible kinase (SGK), Re- ulated in RCC tissues compared with adjacent nal cell cancer (RCC), Western blot (WB), Guanosine normal tissues, and the SGK2 expression also triphosphatase (GTPase), Growth factor receptor-bound increased in various RCC cell lines compared protein 2 (GRB2), Extracellular regulated protein kinases to that in the normal epithelial cell line HK-2. (ERK), Protein kinase B (AKT/PKB), Copy number vari- Meanwhile, the SGK2 expression was signifi- ation (CNV), Dulbecco’s modification of Eagle medium cantly associated with the survival rate of RCC (DMEM), Fetal bovine serum (FBS), Sodium dodecyl patients. Functional experiments showed that sulfate-polyacrylamide (SDS), Polyvinylidene difluoride silencing SGK2 expression inhibited RCC cells (PVDF), Bovine Serum Albumin (BSA), Glyceralde- proliferation, migration, colony formation and hyde-3-phosphate dehydrogenase (GAPDH), Serine (Ser), invasion abilities in vitro, whereas opposite re- Threonine (Thr), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphe- sults were uncovered after overexpressing SGK2 nyl-2-H-tetrazolium bromide (MTT), Mitogen-activat- in RCC cells. Furthermore, functional analyses ed protein kinase (MAPK), Phosphoinositide 3-kinase showed that SGK2 related genes were associ- (PI3K), The Cancer Genome Atlas (TCGA). ated with protein serine/threonine kinase activ- ity, guanosine triphosphatase (GTPase) activity, guanyl-nucleotide exchange factor activity, and motor activity. Protein interaction analysis iden- Introduction tified that growth factor receptor-bound protein 2 (GRB2), one of the most important upstream Renal cell carcinoma (RCC) is one of the most components in the growth factor signaling path- frequent and malignant neoplasms which accounts way, was significantly enriched in SGK2 related for 5% in men and 3% in woman of all oncologi- genes. In addition, the WB assay validated that 1 SGK2 could promote the phosphorylation of cal diagnoses . Although most detected tumors are ERK 1/2 and AKT. small in size, metastatic RCC patients continue to 2756 Corresponding Author: Chaozhao Liang, MD; e-mail: [email protected] Xiongbing Zu, MD; e-mail: [email protected] SGK2 promotes renal cancer progression via enhancing ERK 1/2 and AKT phosphorylation be diagnosed at a notable proportion, with up to epithelial cell line, HK-2 were obtained from 17% at the time of diagnosis2. Furthermore, for Shanghai Institute of Cell Biology, Chinese these patients with distant metastasis, the 5-year Academy of Sciences and were cultured in survival rate is less than 10%3,4. Currently, surgery DMEM medium (Gibco Life Technologies, or targeted therapies such as immunological thera- Grand Island, NY, USA) supplemented with py5-7 are preferred as the best treatment option for 10% FBS (HyClone, South-Logan, UT, USA), these patients, while many of them suffered recur- 2 mM L-glutamine (Sigma-Aldrich, St. Louis, rence eventually. Therefore, it is of great signifi- MO, USA) and 100 U/ml penicillin (Sigma-Al- cance to identify specific molecular biomarkers for drich, St. Louis, MO, USA) in an incubator at early diagnosis and therapeutics in RCC patients. 37°C with 5% CO2. The serum- and glucocorticoid-inducible ki- nases (SGKs) participate in regulating diverse Lentivirus Packaging and Infection cellular processes, including osmoregulation, cell The shVector, shSGK2, oeVector, oeSGK2, survival, sodium homeostasis, cell proliferation, psAX2 packaging plasmid, and pMD2G enve- and invasion8-13. The SGK family comprises three lope plasmid, were mixed and then transfected members, SGK1, SGK2, and SGK3. A previous into 293T cells using the protocol of calcium work14 suggests that the role of SGK2 within the chloride mediated transfection. The virus was human kidney is different from that of SGK1 and collected after 48 h of culture, then immediately SGK3. SGK1 and SGK3 are commonly expressed frozen at -80°C for future use. Cells were seeded in a wide variety of tissues, while SGK2 is more in a 6- well plate, and the virus supernatant was likely expressed in liver, kidney, and brain15. Fur- directly added to the cells in the 6- well plate and thermore, aldosterone has been shown to regulate maintained for 24 h. After 48 h of culture, cell SGK1 and SGK3, rather than SGK2 in the kidney. protein was collected to test infection efficiency. Although the biological roles of the SGK family The shSGK2 sequences were as follows: Sense: are not well characterized, studies have indicated GCACCTGAAGTGCTTCGGAAA, anti-sense: that the SGK family shares approximately 50% TTTCCGAAGCACTTCAGGTGCT. amino acid sequence homology with many kinase domains that can promote the phosphorylation of Western Blotting Analysis AKT, a key kinase involved in the regulation of Total protein was collected from the cells us- the progression of diverse tumors progression16. ing cell lysis buffer. After quantification, equal To date, few studies have been conducted amounts of protein were subjected to sodium do- concerning the role of SGK2 and tumor progres- decyl sulfate-polyacrylamide (SDS) gel electro- sion, and no study was identified investigating the phoresis and transferred to polyvinylidene diflu- role of SGK2 in renal cancer. We first extracted oride (PVDF) membranes (Millipore, Bedford, mRNA data from the TCGA database and found MA, USA). The PVDF membrane was blocked that SGK2 was elevated in renal cancer tissues in 5% Bovine Serum Albumin (BSA) (Sigma-Al- compared with para-tumor tissues. The SGK2 drich Corp., St. Louis, MO, USA) for 1 h and then protein level was also increased in several renal incubated with primary antibody overnight at 4°C, cancer cell lines compared with that in normal followed by the secondary antibodies for 1 h at epithelial HK-2 cells. In addition, a copy number room temperature. Antibodies used in the current variation (CNV) of SGK2 referenced in the On- work included mouse anti-human SGK2, GRB2, comine database suggested that a high level of ERK1/2, p-ERK1/2 and GAPDH monoclonal an- SGK2 CNV was related to a late tumor stage and tibodies (Santa Cruz Biotechnology, Santa Cruz, a high rate of tumor recurrence. Overall, based on CA, USA), and AKT/p-AKT (Thr308/Ser473) previously published work and our preliminary monoclonal antibody (CST, Denver, MA, USA). data, we hypothesized that SGK2 might promote Protein bands were checked using the Bio-Rad renal cancer progression. Imaging System (Hercules, CA, USA). Transwell Mediated Migration Materials and Methods and Invasion Assays For the transwell migration assay, approxi- Cell Culture mately 1 × 104 cells/well were seeded. Cells were ACHN, A498, 786-0, OSRC-2 and Caki-1, re-suspended in 180 μL of serum-free DMEM as well as an immortalized proximal tubule and placed on the upper chamber of the 24-well 2757 Y. Liu, J.-B. Chen, M. Zhang, X.-L. Zhang, J.-L. Meng, J. Zhou, Z.-Y. Hao, L. Zhang, X.-B. Zu, C.-Z. Liang Transwell plate with an 8.0 μm pore polycar- Statistical Analysis bonate membrane insert (Corning, Corning, NY, All the statistical analyses were conducted USA). A total of 700 μL of cell culture medium using GraphPad Prism 6.0 software (San Diego, containing 10% FBS was added to the lower CA, USA). Data are shown as the mean ± stan- chamber. After 24 h in culture, the cells on the dard deviation (SD). The Student’s t-test was used upper chamber were scraped off carefully by a to calculate the raw data, and a value of p less moist cotton swab, and then, the cells transferred than 0.05 was treated as statistically significant. to the other side of the upper chamber were fixed with 100% methanol for 15 min followed by 0.1% crystal violet solution staining for 15 min. Results We captured five random fields to calculate the number of migrated cells under a microscope. SGK2 is Significantly Upregulated For the transwell invasion assay, approximately in RCC Tissues & Cell Lines and Related 5 × 104 cells were seeded in each well, and all to RCC Patient Prognosis the procedures were similar to the transwell mi- Until now, there has been no study document- gration assay, except for the use of Matrigel (BD ing the expression and functional role of SGK2 in Biosciences, Franklin Lakes, NJ, USA) to coat renal cancer.