Indian Journal of Experimental Biology Vol. 57, December 2019, pp. 923-930 Spatial genetic variation in South Indian larval populations of legume pod borer, Maruca vitrata Geyer (Lepidoptera: Crambidae) S Sambathkumar1*, C Durairaj1, S Mohankumar2, B Preetha2, R Aravintharaj2 & N Ganapathy1 1Department of Agricultural Entomology; 2Department of Plant Biotechnology, Tamil Nadu Agricultural University, Coimbatore-641 003, Tamil Nadu, India Received 27 February 2017; revised 15 February 2019 The Legume pod borer Maruca vitrata (Fabricius) is a serious pest in most common pulses affecting their yield. In the present investigation, genetic diversity among larval population of Maruca vitrata from five locations of India was assessed using 23 RAPD primes and 6 SSR primers. RAPD primers produced 364 (98.9% polymorphism) polymorphic alleles with the mean number of 18.2 alleles/primer while SSR primers produced 45 polymorphic alleles with 68% polymorphism. The mean number of alleles detected per primer ranged from 4 to 46 and 5 to 12 with RAPD and SSR primers, respectively in different larval samples. Dendrogram constructed using similarity index values for RAPD and SSR primers differentiated the larval samples. In all three types of Maruca larval samples, Polymorphism information content (PIC) value observed for RAPD primers ranged from 0.019 (OPC 08) to 0.375 (OPAF 12). Similarly, SSR primers showed PIC value of 0.061 (C32008E) to 0.781 (C3393E,1) irrespective of larval samples. Keywords: Polymorphism, Pulses, RAPD Primer, SSR Primer Legume pod borer, Maruca vitrata (Geyer) for M. vitrata. Existence of different species of (Lepidoptera: Crambidae), is considered as the most M. vitrata is already reported10,11 and it is hard to serious pest of food legumes in tropical Asia, identify and distinguish the correct species using sub-Saharan Africa, South America, North America, morphological characters because of their tough Australia and the Pacific1. It is already reported on species complex12. Apart from M. vitrata, other species 45 different host plant species, especially on legumes viz., M. amboinalis (Felder), M. aquitilis (Guérin- in tropical Asia and sub-Saharan Africa2,3. The larvae Méneville), M. bifenestralis (Mabille), M. fuscalis feed upon flowers and pods of leguminous plants by (Yamanaka), M. nigroapicalis (Joannis), M. simialis webbing on them and cause significant yield loss to (Snellen) and M. Testulalis (Geyer) were also reported legumes4-6. Hence, M. vitrata is can be considered as a and M. testulalis was found to be synonymous with major emerging threat to legume production in many M. vitrata. M. amboinalis and M. nigroapicalis were developing and underdeveloped nations. In India, observed in the Indo-Malaysian and Tonkin area, the M. vitrata is one of the major pests of pulses, especially most probable centre of origin for the genus Maruca13,14. during flowering and pod formation stages. At present, However, in India, only the incidence of M. vitrata is chemicals are mainly used to control this pest, and in reported so far. We have recently reported the many occasions it is not effective in managing, detoxifying enzyme profile and developmental particularly the larval stages. This might be attributed to flexibility that M. vitrata possess to overcome pesticides the construction of webbing around the larvae which in fields by analyzing gut hydrolytic enzymes15. In shields them from insecticide sprays, existence of consideration of above issues, an attempt was made to resistance strains of this species7,8 and high cost of plant study the genetic variation in different populations of M. protection chemicals9. vitrata collected from different parts of pulses growing Lack of sufficient population genetic data on regions in South India. DNA sequences, molecular markers, and population structure hinders the development of IRM protocols Material and Methods Isolation of genomic DNA —————— *Correspondence: Larvae of M. vitrata collected from different E-mail: [email protected] locations of South India (Table 1), such as 924 INDIAN J EXP BIOL, DECEMBER 2019 Table 1—Geographic details of Maruca vitrata larval collection Table 2—List of RAPD primers used for M. vitrata Location State Latitude and Longitude S. No. Primer Sequence (5'-3') TNAU, Coimbatore Tamil Nadu 11.0144120N and 1. OPA 01 CAGGCCCTTC 76.9354510E 2. OPA 07 GAAACGGGTG KAU, Vellanikkara, Kerala 10.5474690N and 3. OPA 08 GTGACGTAGG Thrissur 76.2833450E 4. OPA 13 CAGCACCCAC Lam, Guntur Andra Pradesh 16.3693280N and 5. OPA 15 TTCCGAACCC 80.4270880E 6. OPA 20 GTTGCGATCC Kollegal, Karnataka 12.1537100N and 7. OPAF 12 GACGCAGCTT Chamrajnagar 77.111100E 8. OPAF 13 CCGAGGTGAC Aurangabad Maharashtra 19.9063760N and 9. OPAF 14 GGTGCGCACT 75.3465560E 10. OPAG 10 ACTGCCCGAC 11. OPBB 03 TGGCGCACAC Coimbatore, Thrissur, Guntur, Chamrajnagar, and 12. OPBB 13 CCTACCGTGG Aurangabad. DNA was individually extracted from 16 13. OPBB 15 AAGTGCCCTG larva of M. vitrata using modified CTAB method . 14. OPC 02 GTGAGGCGTC Agarose gels (0.8%) were used to analyze the 15. OPC 04 CCGCATCTAC quality of DNA samples. After the run, the gel was 16. OPC 08 TGGACCGGTG examined and documented using gel documentation 17. OPC 15 GACGGATCAG (Bio-Rad, USA). The quantification of DNA was 18. OPE 04 GTGACATGCC done by using Nano drop Spectrophotometer 19. OPE 08 TCACCACGGT (ND – 1000). The absorbance for all samples was 20. OPE 15 ACGCACAACC measured at 260 to 280 nm. Based on the quantity 21. P 210 AAATGCGGCA of DNA, dilutions were made in TE buffer to a final 22. P 225 AGTGGTCGCG concentration of 50 ng/µL and stored in -20°C for 23. P 443 GCCGTGATAG further use. 24. S 34 GATAGCCGAC RAPD primers analysis of M. vitrata Table 3—List of SSR primers used for M. vitrata Annealing Isolated larval DNA samples of M. vitrata were Loci Sequence (5'-3') subjected to Random Amplified Polymorphic DNA temp. E O (RAPD) primer analysis using RAPD primer sets C32008 F-(MAX)AAAAAGCGCTTATATGTTTGTTATAGT 57 C R-GAAATTTTTAACGGAGATACAATCA (Table 2) OPERON random primers according to A O Williams et al.17 and the variation with respect to 7_02K06 F-(FAM)ATTTGTCAGAATGGTATCTTACGT 52 C R-CCTCTGGGTCATAATTATATTGTTCA genomic DNA was confirmed by PCR amplification. E,1 O C3393 F-(ROX)AGACCCCCAAAGTGGAGAA 55 C RAPD analysis and PCR conditions R-ACGTTCACGAACCTCCTGTT PCR mixtures (25 μL volume) contained 2 μL of C0444E,1 F-(FAM)AAAGGAACTACGCCGTCAGG 57O C template DNA (50-150 ng/µL) followed by 2.5 μL R-GTTGAGCGATCTTGGCACAG E 10×PCR buffer, 0.5 μL of MgCl2, 1.0 μL dNTP C0241 F-(TAM)GACGAAACAAGGCCTACCAG mixtures (200 M/L each of dATP, dCTP, dGTP and R-GGTACTTCYGACGTTGTTCG dTTP), 1.0 μLeach of RAPD forward and reverse C0325E F-(ROX)CGAAAAGAAACACCGCTCTG primer, 0.5 μL Taq DNA polymerase (1.5U), and R-CAGTCTGTTCAGWCTCTTCAGTGG 16.5 μL distilled water. PCR amplification was documented in image documentation system performed in thermocycler (Bio-Rad DNA engine) (Bio-Rad USA). programmed for initial denaturation at 94°C for 5 min; 40 cycles of denaturation at 94°C for 1 min, SSR primer analysis of M. vitrata annealing at 40°C for 1 min, extension at 72°C for Six SSR primers (Table 3) were used to assess the 2 min and a final extension step at 72°C for 7 min. genome of larval populations of M. vitrata from five 18 Reaction tubes were held at 4°C prior to visualization different locations of South India . The PCR reaction of PCR products in a 2% agarose gel stained with mixture (25 μL) contained 25 μL of DNA, 2.5 μL of 0.5 µg/mL ethidium bromide. Finally, the amplified 10 × PCR buffer, 10.5 μL of MgCl2 (1.2 M), 1.0 μL PCR products were viewed under UV light and each dNTPs (mixture of dATP, dCTP, dGTP and SAMBATHKUMAR et al.: SPATIAL GENETIC VARIATION IN LARVAL POPULATIONS OF MARUCA VITRATA 925 dTTP), 1.0 μL each of forward and reverse primers Data analysis and 0.5 μL of 1.25 U Taq DNA polymerase enzyme Clearly resolved, unambiguous polymorphic bands (Fermentas, USA). The DNA was amplified using the obtained out of RAPD and SSR primers analysis were following conditions as Initial denaturation at 94°C scored either absent (0) or present (1) with the help of for 2 min, followed by 40 cycles of denaturation at Alpha Ease® FC Software (Source: Protein Simple, 94°C for 1 min, annealing of primer at 52 to 57°C for California, USA). Allele scoring was done using the 1 min (Table 3), extending primer at 72°C for 1 min 100 bp primer lane as a reference. The sizes of the and final extension at 72°C for 2 min. alleles are approximated by comparing with the band The amplified bands were separated by denaturing migration distance of the standard 100 bp ladder. The polyacrylamide (6%) gel electrophoresis in TBE total number of fragments , polymorphic fragments , buffer and photographed. It was prepared from the per cent polymorphism and the Nei̓ ’s genetic distance stock solution (acrylamide 29.0 and 1.0 g and distilled (GD) were calculated. The polymorphism information water) by adding 20 mL of polyacrylamide stock content (PIC) values are calculated for each RAPD solution, 10 mL of 10 × TBE buffer, 900 µL of and SSR primers using the following algorithm: ammonium per sulphate (APS) and 100 µL of tetra PIC = 1-f 2i = 1 where f 2 is the frequency of ith methyl ethylene diamine (TEMED). The gel was i i allele21 immediately poured in to the glass plates immediately after adding TEMED (to avoid solidification) without The binary data scored was used to construct a any air bubbles. The gel was pre-run for about 20 min dendrogram. Similarity matrix was generated using before loading the sample and maintained at 70 W for the SIMQUAL programme of NTSYS-pc software, 22 2 h.