Mitochondrial Dna Sequences Coding for a Portion of the Rna of the Small Ribosomal Subunits of Tetragnatha Mandibulata and Tetra

Mitochondrial Dna Sequences Coding for a Portion of the Rna of the Small Ribosomal Subunits of Tetragnatha Mandibulata and Tetra

1991. The Journal of Arachnology 19 :210—214 MITOCHONDRIAL DNA SEQUENCES CODING FOR A PORTION OF THE RNA OF THE SMALL RIBOSOMAL SUBUNITS OF TETRAGNATHA MANDIBULATA AND TETRA GNATHA HA WAIENSIS (ARANEAE, TETRAGNATHIDAE) Henrietta B . Croom: Department of Biology, The University of the South, Sewanee , Tennessee 37375 USA Rosemary G. Gillespie and Stephen R . Palumbi: Department of Zoology, The University of Hawaii at Manoa, Honolulu, Hawaii 96822 USA ABSTRACT. A region of mitochondrial DNA coding for most of the third domain of the 12S rRNA of th e ribosomal small subunit has been sequenced from two spiders in the genus Tetragnatha (Araneae, Tetrag- nathidae): a circumtropical species T. mandibulata and an endemic Hawaiian species T. hawaiensis. The secondary structure of the spider ribosomal RNA shows strong similarity to that of insects . Across this region , the two Tetragnatha sequences are 22% different . The T. mandibulata sequence is 36% different from the homologous segment in Drosophila yakuba and 51% different from the same segment in Homo sapiens. The spider sequences are sufficiently variable to be useful in studying genetic relationships among at least some of the species in this genus. A powerful approach to studying genetic re- tion make it often more instructive than nuclear latedness of species involves DNA sequence DNA in comparing taxa (Wilson et al . 1985). comparisons which can be used to estimate This DNA evolves rapidly at the sequence leve l branching order of phylogenetic trees as well as in arthropods (DeSalle and Templeton 1988; evolutionary distance between extant taxa (Fel- Palumbi and Benzie 1991) and has proven use- senstein 1988) . Recent application of the poly- ful for comparing recently-evolved taxa in Ha- merase chain reaction and direct sequencing ha s waii (DeSalle et al . 1987). accelerated efforts to examine a wide range o f In order to determine nucleotide sequence in taxa with DNA comparisons (Kocher et al . 1989; a particular mtDNA segment, the segment mus t Martin et al . 1990). To date the use of this meth - first be amplified either by genetic cloning or by od in studying spiders has not been reported . using the polymerase chain reaction (Mullis and Here we describe a procedure we have used t o Faloona 1987 ; Saiki et al. 1988). The latter meth - amplify and to determine the sequence of nucle- od depends upon knowledge of oligonucleotide otides of a 279-base-pair region of mitochondrial sequences that flank the segment of interest and DNA (mtDNA) from two species of the genus that serve as primers for enzymatic amplifica- Tetragnatha (Araneae, Tetragnathidae). tion. Kocher et al. (1989) have described uni- Sequencing DNA has the following advantage s versal (highly-conserved) oligonucleotide se- over other techniques of genetic comparison: (1 ) quences flanking a 300-base portion of the third it has greater resolving power over a hierarchica l domain of the 12S ribosomal RNA gene that can range of intraspecific to intergeneric compari- be used to amplify mtDNA from animals as di- sons, (2) sequences are easily compared with verse as humans and invertebrates . The conser- known sequences from other species, and (3 ) vation of these primers makes them useful t o functional information on products encoded by investigators sequencing the DNA of species for DNA allows strong inferences on the selectiv e which there is no previous sequence informatio n importance of mutations observed, allowing (Simon et al. 1990). We first used insect-specific character weighting for sites that are not selec- primers for the 12S rRNA region, slightly mod- tively neutral (Kocher et al. 1989). Mitochon- ified by C. Simon (pers. comm.) from the original drial DNA was chosen for this work because its primers of Kocher et al. (1989), to amplify an d matriarchal inheritance and lack of recombina - sequence the DNA of Tetragnatha mandibulata 210 CROOM ET AL.—TETRAGNATHA MTDNA SEQUENCES 21 1 Walckenaer. We then designed a spider-specifi c location in the Drosophila yakuba mtDNA se- primer based on this sequence to amplify an d quence of Clary and Wolstenholme (1985), wer e sequence the same region from a Hawaiian en- 12St-L (14503), a Tetragnatha-specific primer demic species T.hawaiensis Simon. designed by H . Croom: 5'-GGTGGCATTT- TATTTTATTAGAGG-3' and 12Sbi-H (14214), MATERIALS AND METHOD S an insect-specific primer designed by C . Simon: All solutions used were either sterilized or pre - 5'-AAGAGCGACGGGCGATGTGT-3'. One pared using sterile deionized, distilled water, and µL of the double-stranded product of the first all glass- and plastic-ware were sterile with th e amplification was cycled under the same con- exception of the Centricon tubes (see below) . The ditions as above except that only one primer wa s chelicerae and a front leg of each spider were added to the incubation mixture. This produced placed in 70% ethanol as voucher specimens. a single-strand sequencing template, which wa s Total (genomic) DNA was prepared by homog- processed in a Centricon 30 microconcentrato r enizing a single spider in a 1 .5 mL Eppendorf (Amicon) to concentrate and purify the DN A tube in 200 µL of 25 mM Tris HC1 (pH 7 .5), 100 product. The template was then sequenced by mM EDTA, 2% SDS, and 200 µg/mL Proteinase the dideoxy chain termination method of Sange r K, followed by incubation for 1—2 hr in a water et al. (1977) as described by Engelke et al . (1988), bath at 65 °C . The homogenate was extracted using the primer that had not been used in th e first with phenol, previously-equilibrated with 1 second amplification . DNA from three individ- M Tris HC1 buffer (pH 7 .5), then with 25:24: 1 uals of each species was sequenced in both di- phenol/chloroform/isoamyl alcohol 1 to 4 times rections, and no intraspecific variation was ob- (until all the protein-containing white interface served. was removed), and finally with 24 :1 chloroform/ Homologous sequences of DNA from different isoamyl alcohol . One-half volume of a 7 .5 M taxa were aligned to minimize deletions or ad- solution of ammonium acetate was added to th e ditions using software written by S . R. Palumbi extract to achieve a final concentration of 2 .5 M and C. Parrish. Pairwise percent differences were and mixed well before adding 2½ volumes of calculated by counting only sites where both spe - 95% ethyl alcohol and mixing again . This solu- cies have nucleotides in our aligned sequences. tion was incubated at room temperature for 1 5 One strand of spider DNA was folded to sho w min to allow for DNA precipitation . The DNA its secondary structure using the folded sequenc- was pelleted by centrifugation at 14,000 x g fo r es of insects as a guide (Clary and Wolstenholme 15 min at room temperature, washed with 500 1987; Simon et al . 1990). µL of 70% ethyl alcohol, dried under a vacuum , and resuspended in 25 µL water . Five µL of this preparation was electrophoresed on a 0.8% aga- RESULTS AND DISCUSSION rose gel in Tris-borate buffer and stained with The DNA sequences from the two Tetragna- ethidium bromide as described in Sambrook et tha species were compared with the 12S rRNA al. (1989) to ensure that high molecular-weight genes from both Homo sapiens and Drosophila DNA was present. The preparation is stable in- yakuba (Fig. 1). The two Tetragnatha sequence s definitely when stored at – 20°C. are 22% different from each other, 36% different One µL of a 1 :10 dilution in water of this DNA from the homologous segment in Drosophila and 2.5 units of DNA polymerase from Themus (Clary and Wolstenholme 1985), and 51% dif- aquaticus (Perkin-Elmer Cetus) were incubated ferent from the same segment in Homo (Ander- in 100 µL of buffer containing 67 mM Tris HC 1 son et al. 1981). In comparison, the Drosophila (pH 8.8), 3 mM magnesium chloride, 16 .7 mM and Homo segments differ by 45% . These value s ammonium sulfate, each of four deoxynucleo- are based solely on pairwise nucleotide differ- side triphosphates at 200 µM , and each of tw o ences, ignoring insertions and deletions, using primers at 1µM according to the protocol o f the alignments in Fig. 1 . It is difficult to align Saiki et al. (1988). Thermal profile for 45 cycles nonconserved regions of DNA from distantly - was as follows: (1) DNA melting for 1 min at 94 related groups, so other alignments may yiel d °C, (2) annealing for 1 min at 50 °C, and (3 ) slightly different percentages. Likewise, the dif- polymerization for 2 min at 72 °C to amplify th e ferences here are uncorrected for multiple mu- double-stranded sequence . The primers and their tations at the same site, which has the effect of 212 THE JOURNAL OF ARACHNOLOGY Tetragnatha mandibulata AACATGTTTATTAATCGACATTACACGATTATT 'rT Tetragnatha hawaiensis . T A ATC C . Drosophila yakuba . .C TG T .A .C GGACC . Homo sapiens .G .C . .CTG T .AAC .C . .C .ACC . TACTTTTTTATAA----ATTTTATATACCTCCGTCC--AGA ATAAATTTTTAATA---TT T C AATA .T G . .TT AAAA . AAA .T .GTAATC .G GT . .TATC TT . .A .A .GA .TAA .AA C . .CACC .CT .GC . .TC .GCC G . .A . .TTC . .C .A .CCC .GA .G .AGGCTACA TATTCAAAATAATATTATAATAATTTA GGTAAAGGTGTAGACTTTAAATTAGT—T T AT . .C . .GA A . A . T .AG . .A . A T .— .T .T .A . .A TATCA .A .C CT .A . .TT .A . .AA A .G .A .GCGC . .GTACCC .CGT .AAG .CGTTA . .C C .CA .G .GG .G .CAAG AAATGTGTTACATTAAAAATTATTT----AAGAATTATTTT TTATAA----CAATATA TGA A AA G . .AAC .AA .C .T . .AGT .T . .A . T . .G A . .—T ACGGATAAAA . .G .AA . .A .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    5 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us