Proc. Natl. Acad. Sci. USA Vol. 82, pp. 2320-2324, April 1985 Biochemistry Identification of cDNA clones encoding a precursor of rat liver cathepsin B (proteolytic processing/oligonucleotide probes/thiol proteases/lysosomes) BLANCA SAN SEGUNDO, SHU JIN CHAN, AND DONALD F. STEINER Department of Biochemistry and Molecular Biology, University of Chicago, Chicago, IL 60637 Contributed by Donald F. Steiner, December 17, 1984 ABSTRACT Recentstudies have suggested that many Iy- be involved in the processing of proinsulin to insulin (4, 5), sosomal enzymes, including cathepsin B (EC 34.22.1), may be while the mature forms of the enzyme may play a role in synthesized as larger precursors and proteolytically processed secretory granule turnover (3). to their mature forms.,To determine the structure of the pri- To more fully define the nature of the initial precursor of mary translation product of cathepsin B, we have screened a cathbpsin B, to investigate the processing events involved in phage.cDNA library fordclQnes encoding rat.liVer cathepsin B. generating intermediate and mature forms of the enzyme, We synthesized two extended DNA oligoniucleotides to use as and to gain more insight into those structural features of the hybridization probes: a 50-mner corresponding.to the coding precursor that might be related to the dual targeting of ca- segment for residues 215-231 of mature cathepsin B and a 54- thepsin B during its biosynthesis, we have cloned the ratliv- mer corresponding to residues 117-134. After screening er enzyme. Here we provide a report of the strategy that 600,000 plaques, five clones were obtained that hybridized to prdved successful and preliminary results on the character- the 32P-labeled 50-mer; of these, two (KrCB3 and XrCB5) also ization of two cloned cDNA fragments that encode the ma- reacted with the 54-mer. DNA sequence analysis confirmed ture enzyme and portions of the precursor region. that 'XrCB3 and XrCB5 both encoded rat liver cathepsin B, and the translated sequence is in agreement with the sequence MATERIALS AND METHODS determined (Takio, K., Towatari, T., Katunuma, N., Teller, D. C. & Titani, K. (1983) Proc. NatI. Acad. Sci. USA 80, Materials. Protected nucleotide monomers and reagents 3666-3670], except for a tryptophan for glycine substitution at for DNA synthesis were purchased from Applied Biosys- residue 78 and the presence of two amino acids at the junction tems (Foster City, CA). Oligo(dT)-cellulose was Type T-2 Wite of the light and heavy chains. Moreover, the DNA se- from Collaborative Research. [y)2P]ATP (specific dctivity, quence reveals an open reading frame extending beyond the 5' 5000 Ci/mmol; 1 Ci = 37 GBq), [a-32P]dATP, and [a- (NH2 terminus), and the predicted COOH terminus of the cod- 32P]dCTP (specific activity, 800 Ci/mmol) were from Amer- ing sequence for the mature protein is extended by six amino sham. T4 polynucleotide kinase and deoxynucleoside tri- acids. These results confirm that the biosynthesis of cathepsin phosphates were from P-L Biochemicals. DNA polymerase B involves a larger precursor form and demonstrate the effec- (Klenow fragment) and T4 ligase were from Boehringer tiveness of long oligonticleotide probes for screening to detect Mannheim. Restriction enzyme reactions were performed rare cloned mRNAs. according to the conditions suggested by the manufacturer (New England Biolabs). Nitrocellulose paper was BA 85 Cathepsin 13 is a lysosomal thiol protease that is structurally (0.45 .,um) from Schleicher & Schuell. related to cathepsin H and papain (1). We have recently Synthesis of Oligonucleotide Probes. DNA oligonucleotides demonstrated that the mature 31-kDa form of this enzyme in were synthesized using the phosphoramidite methodology rat islets of Langerhans is immunologically and biochemical- (6) on an Applied Biosystems Model 380A synthesizer and ly closely related to liver cathepsin B and is derived from a were purified by polyacrylamide gel electrophoresis in 7 M larger precursor of =43 kDa (2). We also found that a signifi- urea. Their nucleotide sequence was confirmed by the Ban- cant fraction of cathepsin B and its precursor forms is locat- aszuk method (7). The oligonucleotides synthesized were as follows: Al 30-mer 5'-G-T-C-G-C-C-A-A-C-T-C-C-T-G-G-A-A-T-G-T-C-G-A-C-T-G-G-G-G-C- 3' A2 30-mer 5' -A-T--T-T-G-A-A-G-A-A-G-C-C-G-T-T-G-T-C-G-C-C-C-C-A-G-T-C-G- 3' BI 26-mer 5'-T-C-C-A-C-C-G-G-T-G-A-G-G-G-C-G-A-C-A-C-C-C-C-G-A-A- 3' B2 21-mer 5'-A-A-A-A-T-O-T-G-C-G-A-G-G-C-C-G-G-T-T-A-T- 3' B3 26-mer 5'-C-A-C-A-T-T-T-T-G-T-T-G-C-A-T-T-T-C-G-G-G-G-T-G-T-C- 3' B4 13-mer 5'-A-T-A-A-C-C-G-G-C-C-T-C-G- 3' ed within the insulin secretion granules in addition to the ly- The large probes were assembled by annealing overlap- sosomes in normal islets or ih islet tumor cells (3) and that ping oligonucleotides as shown in Fig. 1 and filling in with precursor is secreted into the medium along with insulin in Escherichia coli DNA polymerase, I. The 50-mer was con- response to glucose stimulation (unpublished data). We have structed by annealing 0.1 ug of each oligonucleotide (Al and suggested that some procathepsin B intermediate forms may A2) in 0.1 M NaCl and successively heating at 70'C for 5 min, 37'C for 20 min, 230C for 20 min, and 40C for 20 min. The 54-mer was constructed in a two-step process (Fig. 1). The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviation: bp, base pair(s). 2320 Downloaded by guest on September 29, 2021 Biochemistry: San Segundo et aL Proc. NatL. Acad. Sci. USA 82 (1985) 2321 150-merl the basis of the amino acid sequence of the mature enzyme Val-Ala-Asn-Ser-Trp-Asn-Val-Asp-Trp-Gly-Asp-Asn-Gly-Phe-Phe-Lys-Ile (1). A general method using pools of short oligonucleotides 5 GTCGCCAACTCCTGGAATGTCGACTGGGGCGACAACGGCTTCTTCAAAAT 3 that include all possible DNA sequences coding for a given 3' CAGCGGTTGAGGACCTTGCAGCTGACCCCGCTGTTGCCGAAGAAGTTCTA 5 amino acid sequence has been widely used (12). Initially, we A T also used two short oligonucleotide mixtures, 14 and 17 nu- cleotides long, corresponding to the predicted coding seg- 54-mer] ment for residues 29-32 (C-C-GA-A-N-G-C-C-C-A-G-C-A) Cys-Thr-Gly-Glu-GIy-Asp-Thr-Pro-Lys-Cys-Asn-Lys-Met-Cys-Glu- Ala-Gly-Tyr and 219-224 (C-C-C-C-A-A-T-C-N-A-C-A-T-T-C-C-A), re- TGCACCGGTGAGGGCGACACCCCGAAATGCAACAAAATGTGCGAG GCCGGTTAT spectively. However, positive results were not obtained ei- ACGTGGCCACTCCCGCTGTGGGGCTTTACGTTGTTTTACAC ther via screening cDNA or genomic libraries with these GCTCCGGCCAATA probes, or by using them as specific primers to prepare FIG. 1. Synthetic oligonucleotide probes used to screen recom- cDNA libraries. We then turned to the use of extended syn- binant phages containing sequences for rat cathepsin B. Sequences thetic oligonucleotides for screening. This method proved underlined are overlapping oligonucleotides that were chemically successful for detecting cathepsin B clones. A similar strate- synthesized. Asterisks denote nucleotides of the synthetic probe gy was used by Ullrich and co-workers for the isolation of that did not match the sequence of the isolated clones. the cDNA encoding the human epidermal growth factor re- ceptor (13) and the gene for human insulin-like growth factor First, a 39-mer was isolated from an annealed and ligated 1 (14). mixture of oligonucleotides B2, B3, and B4 (8). The 39-mer In designing the probes, we selected two regions with low (0.1 ,tg) was then annealed to 0.1 4g of the 26-mer (B1) and codon degeneracy from the central and carboxyl-terminal re- filled in with DNA polymerase. Reactions were carried out gions of cathepsin B. The 50-mer corresponded to a region of in 50 mM Tris HCl, pH 7.5/10 mM MgSO4/70 ,tM dGTP, high homology between cathepsin B and cathepsin H near and dTTP containing 50 ,uCi of [a-32P]dATP, 50 ,Ci of [a- the carboxyl-terminus, while the 54-mer was chosen from a 32P]dCTP, and 2 units of DNA polymerase (Klenow) in a central region where these two enzymes differ (1). Third po- volume of 27 ,ul for 2 hr at 15°C. Reactions were chased for a sition choices were made according to codon usage frequen- further 15 min by the addition of 2 ,ul of 5 mM dNTP, and the cies in mammalian genes (15). After screening 600,000 polymerase was inactivated by heating the reaction mixture 1laques, we found 5 positive clones that hybridized to the at 65°C for 5 min. To increase the specific activity of the 2P-labeled 50-mer, but only two of these (XrcB-3 and XrcB- probes, oligonucleotides Al, A2, and B4 were first labeled to 5) also reacted with the 32P-labeled 54-mer. This suggests high specific activity (12 x 106 cpm/pmol) with T4 polynu- that the remaining positive clones from the initial screening cleotide kinase and [y-32P]ATP.