www.intjdevbiol.com doi: 10.1387/ijdb.130193jg SUPPLEMENTARY MATERIAL corresponding to: Pitx3 directly regulates Foxe3 during early lens development NAFEES AHMAD, MUHAMMAD ASLAM, DORIS MUENSTER, MARION HORSCH, MUHAMMAD A. KHAN, PETER CARLSSON, JOHANNES BECKERS and JOCHEN GRAW *Address correspondence to: Jochen Graw. Helmholtz Centre Munich – German Research Center for Environmental Health, Institute of Developmental Genetics, Ingolstädter Landstr. 1, D-85764 Neuherberg, Germany. Tel: +49-89/3187-2610. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.130193jg TABLE S1 PROBES FOR EMSA Gene Probe Sequence* Foxe3 Fox3-1-EMSA 5’-Biotin-AATCCCTGGCCATTAATCCCTCCTGCCAGCCC-3’ Fox3-2-EMSA 5’-Biotin-ACGCTGAAAACGCGGATTAGCCCTTGGGCCGC-3’ Prox1 Prox1-EMSA 5’-Biotin-AGGGGGGGCAGTTTAATCCTGTTAAATGTGGT-3’ Tube1 Tube1-3-1-EMSA 5’-Biotin-GACAAGCTGCTAATAAGCTGTTTCTGCCATCT-3’ Tube1-3-2-EMSA 5’-Biotin-TGTAATAACAAACTAAGCTGTATCCTGGCGGC-3’ *Pitx3 putative binding sites are underlined. TABLE S2 PRIMERS FOR GENOTYPING OF APHAKIA MICE Product size (bp) Primer Sequence Annealing (oC) wt ak Pitx3-1/2NF 5’-ATTCGGTGCGGAGAGTAAGG-3’ 63 1,165 399 Pitx3-2R 5’-ATTGGATTTGGCTCTGATGGTT-3’ TABLE S3 PRIMERS FOR RT-QPCR Annealing Product Gene Primer Sequence (oC) size (bp) E4f1 E4FqF 5’-AGTACATTATTGAGGCCACTGC-3’ 60 219 E4FqR 5’-CAATGGTGATCGTGTCTGC-3’ Foxe3 Foxe3-lt 5’-GCCGCCCTACTCATACATC-3’ 60 172 Foxe3-rt 5’-ACAGTCGTTGAGGGTGAGG-3’ Prox1 Prox1qF 5’-ATGCTGTGTCTCCTGTTTCTCT-3’ 60 101 Prox1qR 5’-GCTTATCAGGCTCAAATCAAAC-3’ Tuba* TubeaF 5’-CCAGATGCCAAGTGACAAGA-3’ 60 117 TubeaR 5’-GTGGGTTCCAGGTCTACGAA-3’ Tube1 Tube1-mqF 5’-CAGTGCTTCTTCATCATCCA-3’ 60 126 Tube1-mqR 5’-GGAAGGATAAACCGCTGTC-3’ *: Primers from qprimerDepot (http://mouseprimerdepot.nci.nih.gov/) TABLE S4 PRIMERS FOR CLONING OF FOXE3 PROMOTER AND CHIP-PCR Annealing Product Primer Sequence temperature (oC) size (bp) Foxe3ch-1F 5’-CAGAGTGGAGCAAGCTGGTG-3’ 58 162 Foxe3ch-1R 5’-TAAGACGGCCAGTGAAGGTG-3’ Foxe3ch-2F 5’-TAAGACGGCCAGTGAAGGTG-3’ 58 283 Foxe3ch-2R 5’-CTTTGGACAAGGGTGGGAAT-3’ Foxe3ch-1F 5’- CAGAGTGGAGCAAGCTGGTG-3’ 58 401 Foxe3ch-2R 5’-CTTTGGACAAGGGTGGGAAT-3’ TABLE S5 PRIMERS FOR SITE DIRECTED MUTAGENESIS Primer Sequence Prox1-mut GTAAAAATAAAGGGGGGGCAGTTTGTTAAATGTGGTGCG Foxe3-mut1 CAATCCCTGGCCATCTCCTGCCAGCC Foxe3-mut2 CGCTGAAAACGCGCCCTTGGGCCG Pitx3 Pitx3/DAPI Prox1 Prox1/D API a b c d 5 5 . 1 1 1 1 E E Supplementary Fig. S1. Analysis of Pitx3 and Prox1 expression in Foxe3 mutant. Immunofluoresence staining for Pitx3 (a) and Prox1 (b) was performed on sections from Foxe3 mutant embryos at E11.5. Co-staining for both of these genes revealed that their expression completely overlap in this mutant (c); however, the expression of Prox1 is observed more anterior compared to the wild-type lens (Fig. 2o) at this stage, indicating that Foxe3 inhibits Prox1. Immunofluoresence staining was performed on 8m m thick, PFA fixed paraffin sections. Scale bars, 50m m. A B ) s ) 0.0 d s 2.0 l E 12.5 d l E 11.5 o f o ( f ( n 0.5 n 1.5 o i o i s s s s e 1.0 r e 1.0 r p p x * x * e e 0.5 e 1.5 e v v i i t t a a l l e e 0.0 r 2.0 r wt ak wt ak Supplementary Fig. S2. RT-qPCR was performed at E11.5 for E4f1 (A) and at E12.5 for Tube1 (B) using RNA from the head of littermate embryos. Expression is shown as fold changes of values normalized to Tuba and calculated using 2-ΔΔCT method. Values from wild-type samples are represented as one. Data represents mean ± standard deviations from three samples run in duplicate. Statistical analysis was done using student’s t test. p≤0.05. wt ak p=<0.05 ) 1.5 s d l o f ( p e n o s i 1.0 s 5 V s . e L r * 0 / p 1 x r * e E 0.5 o * f e v i t V a L l e r 0.0 Foxe3 Prox1 wt ak p=<0.05 ) 1.5 s d l g o f n ( o l n o e i 1.0 s 5 s C . e F r 1 * p / 1 x * E e p 0.5 e e v s i t a l V e L r 0.0 Foxe3 Prox1 Supplementary Fig. S3. Quantification of Foxe3 and Prox1 transcripts at different developmental stages (adopted from Lang, 2004 and http:// www.mc.vanderbilt.edu/) using RNA from the head of littermate embryos. Expression is represented as fold changes normalized to Tuba and calculated using 2-ΔΔCT method. Values from wild-type samples are represented as one. Data represents means ± standard deviations from five samples run in duplicate. Statistical analysis was done using student’s t test. p = < 0.05. Abbreviations: LV for, lens vesicle formation; LV sep, lens vesicle separation; FC elong, fiber cell elongation..