RESEARCH ARTICLE Genome Analysis of Staphylococcus agnetis, an Agent of Lameness in Broiler Chickens Adnan A. K. Al-Rubaye1,2☯, M. Brian Couger3☯, Sohita Ojha1,2, Jeff F. Pummill4, Joseph A. Koon II5, Robert F. Wideman, Jr.1,6‡, Douglas D. Rhoads1,2‡* 1 Interdisciplinary Graduate Program in Cell and Molecular Biology, University of Arkansas, Fayetteville, AR, United States of America, 2 Department of Biological Sciences, University of Arkansas, Fayetteville, AR, United States of America, 3 Department of Microbiology, Oklahoma State University, Stillwater, OK, United States of America, 4 Arkansas High Performance Computing Center, University of Arkansas, Fayetteville, AR, United States of America, 5 Department of Biology, Ouachita Baptist University, Arkadelphia, AR, United States of America, 6 Department of Poultry Sciences, University of Arkansas, Fayetteville, AR, United States of America ☯ These authors contributed equally to this work. ‡ These authors also contributed equally to this work. * [email protected] OPEN ACCESS Abstract Citation: Al-Rubaye AAK, Couger MB, Ojha S, Pummill JF, Koon JA, II, Wideman RF, Jr., et al. Lameness in broiler chickens is a significant animal welfare and financial issue. Lameness (2015) Genome Analysis of Staphylococcus agnetis, can be enhanced by rearing young broilers on wire flooring. We have identified Staphylo- an Agent of Lameness in Broiler Chickens. PLoS coccus agnetis as significantly involved in bacterial chondronecrosis with osteomyelitis ONE 10(11): e0143336. doi:10.1371/journal. pone.0143336 (BCO) in proximal tibia and femorae, leading to lameness in broiler chickens in the wire floor system. Administration of S. agnetis in water induces lameness. Previously reported in Editor: Gabriel Moreno-Hagelsieb, Wilfrid Laurier University, CANADA some cases of cattle mastitis, this is the first report of this poorly described pathogen in chickens. We used long and short read next generation sequencing to assemble single fin- Received: June 9, 2015 ished contigs for the genome and a large plasmid from the chicken pathogen. Comparison Accepted: November 3, 2015 of the S. agnetis genome to those of other pathogenic Staphylococci shows that S.agnetis Published: November 25, 2015 contains a distinct repertoire of virulence determinants. Additionally, the S. agnetis genome Copyright: © 2015 Al-Rubaye et al. This is an open has several regions that differ substantially from the genomes of other pathogenic Staphylo- access article distributed under the terms of the cocci. Comparison of our finished genome to a recent draft genome for a cattle mastitis iso- Creative Commons Attribution License, which permits late suggests that future investigations focus on the evolutionary epidemiology of this unrestricted use, distribution, and reproduction in any medium, provided the original author and source are emerging pathogen of domestic animals. credited. Data Availability Statement: All sequences were deposited in NCBI under Accession PRJNA246192 and BioSample SAMN02743857. All additional analyses were using the two contigs with the terminal repeats corrected and the 5’ repeat removed and Introduction these sequences have been deposited in Genbank at NCBI.NLM.NIH.gov as CP009623 and CP009624. Lameness is a significant animal welfare issue resulting in millions of dollars of losses annually for the broiler industry. A model for inducing lameness at high frequency in broilers has been Funding: Support was provided by the Arkansas developed using growth on an elevated wire floor [1]. Lameness in this model is predominantly Biosciences Institute, by the Translational Research Institute (UL1TR000039) through the NIH National associated with bacterial chondronecrosis with osteomyelitis (BCO) of the proximal tibiae and Center for Research Resources and National Center femora. Different broiler lines have been shown to be susceptible but there may be some line for Advancing Translational Sciences, and by the differences and sire-effects [2, 3]. A model for BCO susceptibility based on the vasculature and PLOS ONE | DOI:10.1371/journal.pone.0143336 November 25, 2015 1/18 Genome Analysis of Staphylococcus agnetis core facilities supported by the Center for Microbial growth plate dynamics has been described [4, 5]. To investigate this further we have cultured Pathogenesis and Host Inflammatory Responses bacteria from lame birds with BCO and used rDNA sequencing to evaluate the species involved (P20-GM103450). J. A. Koon was supported by the in BCO generated in broilers using the wire floor model. Previously, many different opportu- Arkansas INBRE program, supported by grant funding from the National Institutes of Health (NIH) nistic organisms have been reported from BCO lesions, including Staphylococcus aureus, National Institute of General Medical Sciences Staphylococcus spp., Escherichia coli, and Enterococcus cecorum, including mixed infections (NIGMS) (P20 GM103429) (formerly P20RR016460). with Salmonella spp. [6–16]. We now report that for broilers raised on wire-flooring on our The funders had no role in study design, data research farm, the vast majority of BCO lesions from clinically lame birds yield a single species, collection and analysis, decision to publish, or Staphylococcus agnetis, previously associated with mastitis in cattle [17] and the gut of sheep preparation of the manuscript. mites [18]. We also report the sequence, assembly and analysis of the complete genome of this Competing Interests: The authors have declared emerging pathogen. that no competing interests exist. Materials and Methods Ethics Statement All animal procedures were approved (protocols08036, 11002, and 14005) by the University of Arkansas Institutional Animal Care and Use Committee to ensure compliance with all applica- ble provisions of the United States of America Animal Welfare Act and other federal statutes and regulations relating to the use of live vertebrate animals in research and teaching. Broilers appear to purposefully avoid exhibiting overt symptoms of lameness in order to avoid being victimized by the predatory behavior of their flock mates. Fast growing and clinically healthy broilers showing no apparent gait abnormalities nevertheless can, within 24 hours, exhibit early symptoms of lameness (hesitancy to stand, eagerness to sit, slight wing-tip dipping). Accordingly, to minimize the birds’ distress, beginning on day 15 and continuing through day 56 all birds were observed walking at least once per day and were humanely euthanized as soon as they exhibited the earliest symptoms of lameness. Gallus gallus Pathogenicity Model for BCO Boiler chicks were reared on the wire floor model developed and patented by R. F. Wideman [1, 3]. Overtly lame birds were identified, and blood was collected from wing veins after surface sterilization with 70% ethanol using EDTA-vacutainers. Blood samples (0.1 ml) were directly plated on agar media. Birds were then euthanized by cervical dislocation. To aseptically sample the proximal femora and tibiae the skin was drenched with 70% ethanol. An incision through the dermis covering the inner thigh was made with an ethanol sterilized scalpel and the entire dermal layer was peeled away to expose the leg. The exposed musculature was drenched with 70% ethanol, then incisions were made with an ethanol sterilized scalpel at the joints which were then bent at an acute angle to expose either the articulated surfaces. The proximal femora and tibiae were visually scored for lesion type [2, 3] then sampled with a Sterile Cotton Tip Applicator (Puritan Medical Products, Guilford, MA). Depending on the experiment, the applicator was then used to either inoculate 3 ml of broth or directly rubbed over the surface of agar plates. Media tested for growth included: Brain Heart Infusion Nutrient, BBL Levine Eosin Methylene Blue, Tryptic Soy, BBL Mannitol Salt, and Difco m Staphylococcus (Becton Dickinson, Franklin Lakes, NJ), also Salmonella Shigella, and Selenite (Neogen Acumedia, Lan- sing MI), and Gelatin Mannitol Salt (Himedia Laboratories, India). Broth inoculums were allowed to grow overnight and then streak plated onto the same medium for individual colo- μ nies. Individual colonies were sampled with a sterile toothpick into 50 l of sterile H2Oin 200 μl PCR plates, sealed and incubated at 100°C for 15 minutes then cooled to 4°C. These extracts were used to PCR amplify specific regions of the 16S rDNA using universal prokaryote primers Bact-8F (5’-AGAGTTTGATCCTGGCTCAG), paired with either Bact-1391R (5’- GACGGGCGGTGTGTRCA), or Bact-936R (5’- GTGCGGGCCCCCGTCAATTC) adapted from PLOS ONE | DOI:10.1371/journal.pone.0143336 November 25, 2015 2/18 Genome Analysis of Staphylococcus agnetis [19]. Sequencing was using the same single primers and performed by the University of Arkan- sas DNA Resource Center. Sequences were aligned and manually edited using the SeqMan module of the LaserGene software package (DNAStar, Madison, WI). Edited sequences were then identified to species using the Ribosomal Database Project (http://rdp.cme.msu.edu/ index.jsp) using Seqmatch (settings were Strain: Both, Source: Isolates, Size: <1200, Quality: Good, Taxonomy: Nomenclatural, KNN matches: 3). Administration of bacteria in water Chicks were obtained as before and reared on wire flooring. Prior to placement the nipple waterers were flushed and scrubbed with dilute bleach, and then rinsed with tap water. On day 7 and 14 the water supply was switched to gravity feed from 20 L carboys containing tap water. Selected carboys