L-Systems: a Mathematical Paradigm for Designing Full Length Genes and Genomes GJCST Classification Sk

L-Systems: a Mathematical Paradigm for Designing Full Length Genes and Genomes GJCST Classification Sk

Global Journal of Computer Science and Technology Vol. 10 Issue 4 Ver. 1.0 June 2010 P a g e | 119 L-Systems: A Mathematical Paradigm For Designing Full Length Genes And Genomes GJCST Classification Sk. Sarif Hassana,c,1, Pabitra Pal Choudhurya, J.3, G.1.0, I.2.1 Amita Palb,R. L. Brahmacharyc and Arunava Goswamic,1 Abstract- We have shown how L-Systems can generate long kb). This was a phenomenal discovery. Gibson et al (2009) genomic sequences. This has been achieved in two steps. In the [2] in a paper published in Nature Methods showed long first, a single L-System turned out to be sufficient to construct DNA chain could made easily using an elegant experimental a full length human olfactory receptor gene. This however is method in which concerted action of a 5' exonuclease, a only an exon. The more complicated problem of generating a DNA polymerase and a DNA ligase lead to a genome containing both exon and intron, such as that of thermodynamically favored isothermal single reaction. In human mitochondrial genome has been now addressed. We have succeeded in establishing a set of L-Systems and thus the beginning, researchers recessed DNA fragments and this solved the problem. In this context we have discussed the process yielded single-stranded DNA overhangs that recent attempts at Craig Venter’s group to experimentally specifically annealed, and then covalently joined them. In construct long DNA molecules adopting a number of working this process, they could assemble multiple overlapping DNA hypotheses. A mathematical rule for generating such long molecules and surely enough mechanism of action behind sequences would shed light on various fundamental problems making a full chromosome is now ready. But initially to on various advanced areas of biology, viz. evolution of long organize assembly method proposed by Gibson DG et al. DNA chains in chromosomes, reasons for existence of long (2008) [1] four DNA cassettes of 6-kb (which could be had stretches of non-coding regions as well as usher in automated from Yeast genome itself) are needed. But what governs the methods for long DNA chains preparation for chromosome engineering. However, this mathematical principle must have whole yeast genome? In this paper, we are trying to explore room for editing / correcting DNA sequences locally in those a possible underlying mathematical principle for making areas of genomes where mutation and / or DNA polymerase whole genome. has introduced errors over millions of years. We present the We claim that the proposed methodology could be used in whole mitochondrial genome (exon and introns) generated by a an automated system to seamlessly construct synthetic and set of L-Systems. natural genes, for modulation of genetic pathways and Keywords- Human olfactory receptor, L-System finally entire genomes, and could be a useful chromosome ClustalW,Star Model, Assembly Method,Human engineering tool. mitochondrial DNA II. DESIGNING OF HUMAN OR AND MITOCHONDRIAL GENOME I. INTRODUCTION L-System is a deterministic string rewriting system proposed s a working model we fasten our attention on OR1D2, by a biologist Lindenmayer in 1968. P. Prusinkiewicz & A. A human olfactory receptor gene. This consists of a Lindenmayer (1990) used this system to study symmetry in sequence of 936 bp of A, T, C and G. it is worth noting that the plant world [3]. The simplest L-System has been defined 4936 different combinations of the four bases A, T, C, G are as the following: possible. Of these enormous numbers of possibilities, only An L-system is a formal grammar consisting of 4 parts: three have been selected as a human olfactory receptor of A set of variables: symbols that can be replaced by length 936 bp namely OR1D2, OR1D4, and OR1D5 production rules. [http://genome.weizmann.ac.il/horde/]. We will show that a An axiom, which is a string, composed of some number of single L-System can generate the sequence of OR1D2. variables and/or constants. The axiom is the initial state of Gibson DG et al. (2008) [1] from The Craig J. Venter the system. Institute in USA surprised us in a paper [2] by preparing A set of production rules defining the way variables can be whole genome of Mycoplasma genitalium within yeast cells replaced with combinations of constants and other variables. where he and his colleagues could stitch 25 overlapping A production consists of two strings - the predecessor and DNA fragments to form a complete synthetic genome (524 the successor. _______________________________ (2A) L-System Derived Human OR1D2: Assuming that four variables to be A, T, C and G, we define a particular L- About-1a. Applied Statistics Unit, Indian Statistical Institute, 203 B. T. Road, Calcutta, 700108 India. [email protected] System as follows: [P. P. C.]; L-System: (e-mail;[email protected] [S. S. H.]; b. Bayesian Interdisciplinary Research Unit (BIRU), Indian Statistical Set of Variables: A, T, C, and G. Institute, 203 B. T. Road, Calcutta, 700108 India. (e-mail;[email protected] [A. P.] c. Biological Sciences Division, Indian Statistical Institute, 203 B. T. Road, Axiom: C (C is the starting symbol) Calcutta, 700108 India. (e-mail;[email protected] [A.G.]. P a g e | 120 Vol. 10 Issue 4 Ver. 1.0 June 2010 Global Journal of Computer Science and Technology The nucleotide A produces first four consecutive base pairs Production Rule: A → CTG, C→CCA, T→TGC and of the mitochondrial DNA and C, T and G produce next G→GAC consecutive four base pairs respectively. Using this L-System a sequence of 243 bp length can be Now if the number of mismatches of the DNA sequence is generated in the 5th iteration. With a proposed algorithm [4] less than three then an L system could be chosen as: the this can lead to the formation of the following sequence (ii). nucleotide A produces the remaining mismatches and C, T 1ATGGATGGAGCCAACCAGAGTGAGTCCTCACAGT and G all produce A. TCCTTCTCCTGGGGATGTCAGAGAGTCCTGAGCAG But if the numbers of mismatches occur in between two and CAGCAGATCCTGTTTTGGATGTTCCTGTCCATGTAC fifteen then an L-system could be chosen as follows: the CTGGTCACGGTGCTGGGAAATGTGCTCATCATCCT nucleotide C produces first one third of the remaining GGCCATCAGCTCTGATTCCCCCCTGCACACCCCCGT mismatches, T produces next one third, G produces the GTACTTCTTCCTGGCCAACCTCTCCTTCACTGACCT remaining and finally A produces the CTG to achieve the CTTCTTTGTCACCAACACAATCCCCAAGATGCTGGT remaining mismatches in the 2nd iteration of the L-system. GAACCTCCAGTCCCAGAACAAAGCCATCTCCTATG Based on the proposed methodology as stated above, we go CAGGGTGTCTGACACAGCTCTACTTCCTGGTCTCCT on generating the L-system iterations until it crosses the TGGTGACCCTGGACAACCTCATCCTGGCCGTGATG given mitochondrial length. Now we compare the generated GCCTATGATCGCTATGTGGCCAGCTGCTGCCCCCTC sequence with the given mitochondrial sequence and CACTACGCCACAGCCATGAGCCCTGCGCTCTGTCTC mismatching portions are again tried by another set of L- TTCCTCCTGTCCTTGTGTTGGGCGCTGTCAGTCCTC systems following the above pick up policy. And the same TATGGCCTCCTGCCCACCGTCCTCATGACCAGCGTG process is continued until the whole mitochondrial sequence ACCTTCTGTGGGCCTCGAGACATCCACTACGTCTTC is matched. TGTGACATGTACCTGGTGCTGCGGTTGGCATGTTCC In this way we have the following twenty four L-systems‘ AACAGCCACATGAATCACACAGCGCTGATTGCCAC covering the mitochondrial sequence (NCBI database GGGCTGCTTCATCTTCCTCACTCCCTTGGGATTCCT (NC_012920)) as shown in the as given below: GACCAGGTCCTATGTCCCCATTGTCAGACCCATCCT L-System for iteration number 1: GGGAATACCCTCCGCCTCTAAGAAATACAAAGCCT TCTCCACCTGTGCCTCCCATTTGGGTGGAGTCTCCC A --> GATC TCTTATATGGGACCCTTCCTATGGTTTACCTGGAGC C --> ACAG CCCTCCATACCTACTCCCTGAAGGACTCAGTAGCC T --> GTCT ACAGTGATGTATGCTGTGGTGACACCCATGATGAA G --> ATCA CCCGTTCATCTACAGCCTGAGGAACAAGGACATGC ATGGGGCTCAGGGAAGACTCCTACGCAGACCCTTT L-System for iteration number 2: GAGAGGCAAACA936 (ii) A --> ACAG C --> GTCT With the help of BLAST search this is revealed to be the T --> ATCA almost actual sequences of OR1D2. This consists of only an G --> CCTA exon and the real problem is-how to generate a gene like that of human mitochondrial DNA which has sequence L-System for iteration number 3: length of more than 15,000 and contains stretches of introns A --> TCAT in between. C --> AACC T --> TCAC (2B) L-System Derived Human Mitochondrial Genome: G --> GGGA As mentioned above this is a formidable problem and apparently no single L-System can solve it. However, as L-System for iteration number 4: shown below a novel approach consisting of a set of L- A --> TCGG Systems and taking into consideration the fact that this C --> GAGT mathematical principle must allow for editing or correcting T --> CAGG DNA sequences locally, can solve the problem. G --> TATT The whole human mitochondrial DNA is equivalent to any bacterial DNA for the purpose of designing/constructing L-System for iteration number 5: with the help of a set of L-systems. We have a strong belief A --> CGGG that nature might use one nucleotide to start with in order to C --> ATCG construct the whole chromosome and finally the genome. T --> GTTT On the basis of this conjecture, we have been motivated to G --> GTGG pick up the L- system methodology. How we are going to select the set of L systems is a relevant question; let us L-System for iteration number 6: briefly describe the corresponding algorithm as follows: A --> ACGG The design of L systems are as follows where axiom C --> TTCC (starting symbol) for the L system is A. T --> ACGC Global Journal of Computer Science and Technology Vol. 10 Issue 4 Ver. 1.0 June 2010 P a g e |

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    4 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us