J Hum Genet (2008) 53:215–219 DOI 10.1007/s10038-007-0235-1 ORIGINAL ARTICLE Tandem duplications of two separate fragments of the dystrophin gene in a patient with Duchenne muscular dystrophy Zhujun Zhang Æ Yasuhiro Takeshima Æ Hiroyuki Awano Æ Atsushi Nishiyama Æ Yo Okizuka Æ Mariko Yagi Æ Masafumi Matsuo Received: 7 November 2007 / Accepted: 3 December 2007 / Published online: 27 December 2007 Ó The Japan Society of Human Genetics and Springer 2007 Abstract Mutations in the dystrophin gene result in the Introduction most common inherited muscle disease, Duchenne mus- cular dystrophy (DMD). Duplications spanning one or Duchenne muscular dystrophy (DMD) is the most common more exons have been found to be the second most com- inherited muscle disease, affecting 1 in every 3,500 male mon disease-causing mutation in the dystrophin gene. births. This disease is caused by mutations in the dystro- Although the duplicated exons are commonly thought to be phin gene located on Xp21. Deletions involving one or arranged in tandem, rare noncontiguous exon duplications more exons are the most common type of mutation asso- have been disclosed without clarifying their location or ciated with DMD, accounting for nearly two-thirds of all orientation. Here we present the first report that details the cases. Duplications are the second most common type of exact locations and orientations of noncontiguous dupli- mutation in this gene, occurring in approximately 5–10% cations in the dystrophin gene. Multiplex ligation- of DMD patients (Hu et al. 1990; White et al. 2002, 2006). dependent probe amplification analysis of the dystrophin Because the dystrophin gene consists of 79 exons gene of a Japanese boy with DMD revealed that his spanning more than 2,500 kb in the human genome, it has genomic DNA contained duplications of exons from two been difficult to examine every exon for deletions or separate fragments of the gene: one from exon 45 to exon duplications. Instead, PCR amplification of deletion-prone 48 and the other from exon 55 to exon 63. To clarify the exons has been used to genetically diagnosis patients sus- locations and orientations of the duplicated exons, reverse pected of having DMD (Chamberlain et al. 1988; Beggs transcription-nested PCR analysis of dystrophin mRNA et al. 1990). Recently, multiplex ligation-dependent probe was conducted. Interestingly, the extra copies of exons 45– amplification (MLPA) analysis, which is used to examine 48 and exons 55–63 were found to be properly oriented every exon for deletion and/or duplications, has been between exons 48 and 49 and exons 63 and 64, respec- developed, resulting in a marked improvement in the tively. These results indicated that two tandem duplication mutation detection rate (Janssen et al. 2005). events occurred in the dystrophin gene of this patient and Interestingly, MLPA analysis produced ambiguous should contribute to the understanding of the duplication results in eight cases in whom twice as much genomic mechanisms that contribute to the development of DMD. DNA was detected for two separate fragments of the dys- trophin gene (Janssen et al. 2005; White et al. 2006; Zeng Keywords Dystrophin Á Mutation Á Duplication et al. 2007). Although these cases are thought to carry tandem duplications of two separate dystrophin gene fragments, details of the duplicated exon fragments have not been reported, thereby making it possible that the extra genomic fragments were located outside of the dystrophin Z. Zhang Á Y. Takeshima Á H. Awano Á A. Nishiyama Á gene. In this article, we describe a patient with novel & Y. Okizuka Á M. Yagi Á M. Matsuo ( ) noncontiguous duplications in his dystrophin gene; detailed Department of Pediatrics, Graduate School of Medicine Kobe University, 7-5-1 Kusunokicho, Chuo, Kobe 650-0017, Japan mRNA analysis revealed tandem duplication of two sepa- e-mail: [email protected] rate fragments from this gene. 123 216 J Hum Genet (2008) 53:215–219 Case and methods chloroform extraction methods. MLPA was performed with the P034 and P035 kits from MRC-Holland Case (Amsterdam, The Netherlands) as described (Lalic et al. 2005). This technique allowed the full dystrophin gene to More than 400 DMD patients at the Kobe University Hos- be examined for any deletions or duplications. pital were subjected to mutation analysis of their dystrophin genes. Among these patients, 27 cases were shown to carry duplications of contiguous exons. Recently, one case was Polymorphism analysis found to have noncontiguous duplications. The proband (KUCG759) was a 5-year-old boy. At 1 year old, his serum To characterize the duplicated fragments, genomic regions creatine kinase (CK) level was found to be markedly ele- encompassing each set of duplicated exons were amplified vated (12,320–17,712 IU/l), and a muscle biopsy disclosed using primers specific for the flanking sequences (Table 1), no dystrophin-specific staining, confirming a diagnosis of resulting in the amplification of dinucleotide repeat mark- DMD. At 4 years old, the patient’s Gowers’ sign was ers from intron 45 (STR-45) and intron 62 (DI623) positive, and he was referred to our hospital for an exami- (Clemens et al. 1991). Amplified products were directly nation of his dystrophin gene. The Ethics Committee of the sequenced using an automated DNA sequencer (model Kobe University Graduate School of Medicine approved 310; Applied Biosystems, Foster City, CA). this study, and consent was obtained from his parents. MLPA analysis Analysis of dystrophin mRNA DNA was isolated from lymphocytes obtained from the The dystrophin mRNA expressed in lymphocytes was patient and normal individuals using standard phenol– examined by reverse transcription (RT)-nested PCR Table 1 Primer sequence Target region Forward primer Reverse primer gDNA Exon 45 50 TGCCAGTACAACTGCATGTGGTAG 30 50 GCTTATAATCTCTCATGAAATATTC 3 Exon 46 50 GTTTGTGTCCCAGTTTGCATTAAC 30 50 GGCAGAAAACCAATGATTGAATTA 30 Exon 47 50 GGGGTGAGTGTTTCAGTCAATC 30 50 CATATAGCCAAAGCAAACGGTC 30 Exon 48 50 TAAACATTTTGGCTTATGCCTTGA 30 50 TGGTGCCTGTGCCTATTGTGTTAT 30 Exon 55 50 CCATCTTTCTCTTTTTATGGAGTT 30 50 TTGTCCCTGGCTTGTCAGTT 30 Exon 56 50 TACGCCAAGAAAAGGGATTTGAGA 30 50 CCAGTTACTTGTGCTAAGACAATGAGG 30 Exon 57 50 ACACTTCTAGATATTCTGACATGG 30 50 GTCACTGGATTACTATGTGCTTAAC 30 Exon 58 50 GCACCCAGGATTAATTTTGAGAAGA 30 50 CCAGACCCTGGCAGCAAGAAT 30 Exon 59 50 CAGTAGGTTACCCTCTTGTTCAAC 30 50 GGGAAGATAACACTGCACTCAAGT 30 Exon 60 50 CCCTAAAGAGAATAAGCCCAGGTA 30 50 TCCTATCCTCACAAATATTACCATGAA 30 Exon 61 50 GTTGCTTTAGTGTTCTCAGTCTTGGA 30 50 GGATGATTTATGCTTCTACTGCTACTG 30 Exon 62 50 CCTGTTTGCGATGAATTTGACCTC 30 50 ACAGGTTAGTCACAATAAATGCTCTT 30 Exon 63 50 GCAAAAATCATGTTGTTGTTATTG 30 50 CAAGTAACTTTCACACTGCAAACT 30 Intron 45 50 GAGGCTATAATTCTTTAACTTTGGC 30 50 CTCTTTCCCTCTTTATTCATGTTAC 30 Intron 62 50 ACCTGCCTAGTCAAGGTA 30 50 CACTGCCATGGTGAATGATC 30 mRNA Exon 44 4A: 50 TGGCGGCGTTTTCATTAT 30 Exon 46 c46r: 50 CTTGACTTGCTCAAGCTTTTC 30 Exon 47 c47f: 50 TTACTGGTGGAAGAGTTG 30 Exon 52 4D: 50 CGATCCGTAATGATTGTTCTAGC 30 Exon 59 4B: 50 CGGAGTGCAGGTTCAATTTT 30 4F: 50 CCCACTCAGTATTGACCTCCTC 30 Exon 60 c60f: 50 TCAGCACTCTGGAAGACCTG 30 Exon 61 c61f: 50 GCCGTCGAGGACCGAGTCAGGCAGCT 30 123 J Hum Genet (2008) 53:215–219 217 analysis as described previously (Matsuo et al. 1991). 59 and an inner set with a forward primer specific for exon Briefly, total RNA was isolated from peripheral lympho- 61 and a reverse primer complementary to exon 59 cytes, and cDNA was synthesized. A fragment (Table 1). The amplified products were purified and encompassing the duplicated region of exons 45–48 was directly sequenced. amplified using an outer set of primers with a forward primer corresponding to a segment of exon 44 and a reverse primer complementary to a segment of exon 52. Results The PCR product was then used as a template for a second PCR using an inner set of primers with a forward primer MLPA analysis of the dystrophin gene in the index patient specific for exon 47 and a reverse primer complementary to disclosed that all of the exons were present. For a total of exon 46 (Table 1). A fragment encompassing the dupli- 13 exons, however, the signals resulting from MLPA cated region of exons 55–63 was also amplified using two analysis were twice those observed in samples from a sets of primers: an outer set with a forward primer specific normal male control subject, indicating that these exons for exon 60 and a reverse primer complementary to exon were duplicated (Fig. 1). Surprisingly, these 13 exons were 2.000 1.500 1.000 Dosage 0.500 0.000 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 Fig. 1 MLPA analysis of the dystrophin gene. Bars represent the the corresponding exons compared to those obtained from a male amount of amplified product expressed as a ratio to the results control sample. Exons 45–48 and exons 55–63 produced signals that obtained with a control sample. Numbers below the bars indicate the were twice those obtained for the other exons exon numbers. The heights of the bars represent the relative signals of a 1 44 45 46 47 48 45 46 47 48 49 54 55 56 57 58 59 60 61 62 55 56 57 58 59 60 61 62 63 64 79 b 44 45 46 47 48 45 46 47 48 49 50 51 52 60 61 62 63 55 56 57 58 59 c CPP C Exon 48 Exon 45 Exon 63 Exon 55 Fig. 2 RT-PCR amplification of the duplication borders of exons 45– analysis. c RT-PCR products for the index patient (P) and a control 48 and exons 55–63. a The predicted genomic structure of the subject (C) encompassing the duplication breakpoints. PCR products duplicated region of the dystrophin gene. The boxes represent exons were visualized on a gel (top panel). No amplified product was and the numbers in the boxes indicate the exon numbers.