
©2002Wiley-Liss,Inc. genesis34:142–145(2002) LivingSynapticVesicleMarker: Synaptotagmin-GFP YongQ.Zhang,ChristopherK.Rodesch,andKendalBroadie* DepartmentofBiologicalSciences,VanderbiltUniversity,Nashville,TN37235-1634 Received4June2002;Accepted17July2002 Synapsesarethesiteofchemicalcommunicationbe- tweenneuronsandbetweenneuronsandmuscles.The synapticvesicle(SV)isaprominentpresynapticor- ganellewhichcontainschemicalneurotransmittersand fuseswiththeplasmamembranetomediateneurotrans- mission.Thereareabout50orsosynapticproteins whichareeitherintegralvesiclemembraneproteins FIG.1.Mapofsyt-eGFPandsyb-eGFPfusionconstructs.Syt (e.g.,synaptotagmin,syt;andsynaptobrevin,syb)or (accessionnumberM55048)orsyb(neuronalsynaptobrevin,acces- vesicle-associatedproteins(e.g.,cysteinestringprotein, sionnumberS66686)codingregionwasfusedtotheN-terminalof CSP;Fernandez-ChaconandSudhof,1999).Wehave eGFP(enhancedGFP,catalognumber6084-1fromClonTech,Palo transformedDrosophilawithanovelsyt-eGFP(en- Alto,CA;sequenceaccessionnumberU55763)withEcoRIand XhoI.SytcDNA(encodingaproteinof475aminoacids)wasPCR- hancedGFP)fusionprotein,thefluorescencepatternof amplifiedandsequence-confirmedwithapairofprimerssyt.1: whichcolocalizeswithnativeSVproteinsatsynapses, gggaattcattaggggcaacaacacagc(EcoRI)andsyt.3:ccctcgagc suggestingthatthesyt-eGFPfusionproteiniscorrectly cttcatgttcttcaggatctc(XhoI).n-Syb(encoding180aminoacids) localizedasanintegralSVproteinandthereforeagood wasPCR-amplifiedandsequence-confirmedwithapairofprimers syb1:acagccgaattcgctgaggc(EcoRI)andprimersyb2:tcctc SVmarkerinlivingsynapses.Wedemonstratethatthe gagccacgccgccgtgatcgccag(XhoI).TheeGFPfusioncassettes syt-eGFPlinecanbeusedtostudySVdynamicsinvivo werethenintroducedintoDrosophilatransformationvector byfluorescencerecoveryafterphotobleach(FRAP). p{UAST}(seeFlybaseathttp://flybase.bio.indiana.edu/)underthe Thesyt-eGFPfusionwasconstructedasshownin controlofUASandhsp70TATAsequence.Restrictionsitesare Figure1.TheeGFPcarriesdoublesubstitutionofPhe64 labeledintheupperpart;sequencesatjunctionsarespelledoutin thelowerpartwithrestrictionsitesunderlined.ThestopcodonTAA toLeuandSer65toThrandfluoresces35-foldmore (parenthesized)ofsytorsybisreplacedwithgct.NandCindicate intenselythanwild-typeGFPwhenexcitedat488nm, theN-terminalandtheC-terminalendsoftheeGFPfusions,re- basedonspectralanalysisofequalamountsofsoluble spectively.Forsyt-eGFP,theN-terminusisinthevesiclelumenand protein(Cormacketal.,1996).Foursyt-eGFPtransgenic C-terminusinthecytoplasm;forsyb-eGFP,N-terminusisinthe linesweregenerated;onewithinsertionontheXchro- cytoplasmandC-terminusisinthevesiclelumen. mosome,twoonthesecondchromosome,andoneon thethirdchromosome.Alloftheselinesproducedclear fluorescencewhencrossedtoapan-neuronalGAL4 (datanotshown)andlarva(Fig.2A,left),aswellasinthe driver(elav-GAL4,seeFig.2)orasubsetneuronalGAL4 axonallobesofthelarvalmushroombody(Fig.2A, driver4G-GAL4(datanotshown).4G-GAL4isidentified right).Theseneuropilregionsaredenselypackedwith fromanenhancertrapscreenforneuronal-specific neuronalsynapses.Second,atneuromuscularjunction genes;itstartsexpressionatlateembryogenesispan- (NMJ)synapses,wherewehavehigherresolutionof neuronally,butinasubsetofmotorneuronsinthethird singlesynapticboutons,thesyt-eGFPpatternperfectly instarlarvae,andenrichedinmushroombodyinadult matchesthestainingpatternseenwithantibodies brain.TheeGFP-positiveanimals,fromembryosto againstSV-associatedproteins(Fig.2B).Thissuggests adults,canbereadilyrecognizableunderafluorescence thatsyt-eGFPistightlylinkedtoSVs.Third,tofurther dissectingscope.Stockswithexpressionofsyt-eGFPin allneurons(recombinantchromosomecarryingboth elav-GAL4andsyt-eGFPontheXchromosome)orsub- *Correspondenceto:KendalBroadie,DepartmentofBiologicalSciences, VanderbiltUniversity,Nashville,TN37235-1634. setofneurons(recombinantchromosomecarryingboth E-mail:[email protected] 4G-GAL4andsyt-eGFPonthesecondchromosome) PresentaddressforChristopherK.Rodesch:UniversityofUtah,Cell wereestablished. ImagingFacility,Bldg.585,40N.2030E.,SaltLakeCity,UT84112. Multiplelinesofevidenceindicatethatsyt-eGFPis Contractgrantsponsor:NationalInstitutesofHealth,Contractgrant number:HD40654(toKB). presentinSVs,withexpressionsimilartothenativesyt Publishedonline00Month2002in (Fig.2).First,syt-eGFPishighlyenrichedintheneuropil WileyInterScience(www.interscience.wiley.com) regionoftheventralnervecord(VNC)oftheembryo DOI:10.1002/gene.10144 FIG. 2 144 ZHANG ET AL. demonstrate that syt-eGFP is specifically present in SVs, we took advantage of a dynamin mutant shits to drive fusion in the absence of vesicle recycling (Estes et al., 1996). shits mutants block SV endocytosis at restrictive temperature (35°C), causing SV proteins to trap in the plasma membrane. We made a stock that carries shits, elav-GAL4, and syt-eGFP. As shown in Figure 2C, syt- eGFP is redistributed to the periphery of synaptic bou- tons at the restrictive temperature, consistent with it FIG. 3. Imaging of in vivo SV dynamics with fluorescence recovery being restricted to SVs. Based on the enrichment of after photobleach (FRAP). Individual NMJ synaptic boutons of third instar larvae of elav-GAL4, syt-eGFP were photobleached with syt-eGFP in synaptic regions of CNS, identical localiza- 100% 488 nm, 514 nm laser power for 100 milliseconds. Photo- tion with endogenous SV proteins at NMJ synapses, and bleaching and serial image collecting were done on a Zeiss LSM510 the peripheral redistribution of syt-eGFP at shits NMJ laser-scanning confocal microscope (Oberkochen, Germany). A: An synapses at restrictive temperature, we conclude that NMJ synaptic bouton before photobleaching. B,C: The same bou- syt-eGFP is restricted to SVs, similar to the native syt. ton 0 and 1 s after photobleaching. The focally bleached area across the bouton middle is indicated by an arrow in B and is refilled with While synaptic activity can be directly measured using fluorescent SVs in about 1 s after bleaching (C). The FRAP assay on electrophysiology and synaptic vesicle recycling can be the syt-eGFP line can be employed to dissect in vivo SV dynamics studied using uptake of fluorescent marker dyes (Ryan et with a pharmacological and/or genetic approach. Scale bar ϭ 4 m. al., 1996), both of these techniques require that vesicles take part in a full recycle of exocytosis and endocytosis. Therefore, mutations that severely alter the processing of SVs or their mobilization will contain SV subpopula- independent transgenic lines with insertions on all major tions that are inaccessible to these conventional tech- chromosomes (the X, the second, and the third chromo- niques. Genetically engineered syt-eGFP-labeled SV somes) were obtained. All eight lines, when crossed to markers, however, can be used to visualize SVs in mu- either elav-GAL4 or 4G-GAL4, produce eGFP-positive an- tants that have severe effects on SV release, clustering, imals. While syb-GFP(S65T) transgenic flies have become transport, or recycling. Therefore, these markers com- available recently (Estes et al., 2000), we expect that the plement activity-dependent dye loading and electrophys- syb-eGFP line described here will be better suited for iology, techniques that are both better suited for study of some experiments, e.g., biogenesis of SVs, as eGFP ma- mutations which have relatively mild effects on synaptic tures faster to the fluorescent form and folds more effi- activity. Moreover, FRAP analyses of syt-eGFP-labeled ciently than GFP(S65T) (Cormack et al., 1996). In paral- SVs is best used to measure the dynamic intermixing of lel experiments, we observed that the fluorescence of fluorescently labeled SVs with photobleached compart- syt-eGFP is consistently brighter than that of syb-eGFP. ments within synaptic boutons (Fig. 3), which cannot be One plausible explanation is that the fluorescence of achieved by classical electrophysiological assays or dye eGFP is dimmer at lower pH (Tsien, 1998), the lumen of loading. vesicles is acidic (pH 5.6; Miesenbock et al., 1998), and In addition to the syt-eGFP lines, we have also made therefore it quenches the fluorescence of eGFP, as the syb-eGFP transgenic lines (see Fig. 1). In total, eight eGFP end of syb-GFP is inside the lumen (see Fig. 1 Legend). The eGFP end of syt-eGFP, however, is located at the cytoplasmic side of the synaptic membrane (see FIG. 2. syt-eGFP is associated with SVs and labels the neuropils in Fig. 1 Legend). Therefore, the fluorescence of syt-eGFP the central nervous system as well as NMJ synaptic terminals in a will not be affected by the reduced pH in the vesicle pattern identical to antibody staining against synaptic vesicle pro- lumen. tein. A: Syt-eGFP driven by elav-GAL4 reveals neuropil in the VNC of a third instar larva (left). Arrow indicates ventral midline. Scale ϭ We observed that animals with expression of syt-eGFP 20 m. In the third instar larval brain (right), syt-eGFP reveals the driven by 4G-GAL4 are fully viable, whereas animals entire mushroom body (MB). Different parts of the MB are annotated carrying 4G-GAL4, syb-eGFP are lethal at the pupal accordingly (Liu et al., 2000). The two axonal lobes are highly stages. The reason for the syb-eGFP lethality is currently ϭ enriched with the syt-eGFP marker. Scale 50 m. B: Syt-eGFP unknown. One possibility is that syb is a component of colocalizes with ␣-CSP staining in the NMJ synapses. Syt-eGFP is green; ␣-CSP in red. Scale ϭ 5 m. C: Syt-eGFP and endogenous the core complex of membrane fusion (Fernandez-Cha- syt localizes to the peripheral of NMJ synapses when exocytosis con and Sudhof, 1999) and
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages4 Page
-
File Size-