Development 117, 1445-1455 (1993) 1445 Printed in Great Britain © The Company of Biologists Limited 1993 Defects of embryonic organogenesis resulting from targeted disruption of the N-myc gene in the mouse Shoji Sawai1, Akihiko Shimono1, Yoshio Wakamatsu1, Cynthia Palmes1, Kazunori Hanaoka2 and Hisato Kondoh1,* 1Department of Molecular Biology, School of Science, Nagoya University, Nagoya 464-01, Japan 2Division of Animal Models for Human Disease, National Institute of Neuroscience, NCNP, Ogawahigashi, Kodaira, Tokyo 187, Japan *Author for correspondence SUMMARY The highest expression of the N-myc gene occurs during death of the embryos. Analyses indicated that the embryonic organogenesis in the mouse ontogeny, with mutant limbs failed to develop distal structures and the the peak of expression around embryonic day 9.5. development of bronchi from the trachea was defective Homozygous N-myc-deficient mice, produced by germ- in the lungs. The latter defect was largely corrected by line transmission of a disrupted allele in ES cells, devel- addition of fetal calf serum to the culture medium, sug- oped normally to day 10.5, indicating dispensability of gesting that an activity missing in the mutant lung was N-myc expression in the earlier period, but later accu- replenished by a component of the serum. The pheno- mulated organogenic abnormalities and died around type of N-myc-deficient mutant embryos indicated day 11.5. The most notable abnormalities were found in requirement of the N-myc function in many instances of the limb bud, visceral organs (lung, stomach, liver and tissue interactions in organogenesis and also in cell- heart) and the central/peripheral nervous systems, and autonomous regulation of tissue maturation. were highly correlated with the site of N-myc expres- sion. The limb buds and the lungs excised from N-myc- deficient mutant embryos were placed in culture to Key words: N-myc, targeted gene disruption, ES cells, allow their development to stages beyond the point of organogenesis, limb buds, organ culture, mouse INTRODUCTION family, in its spatiotemporal regulation of expression (Zim- merman et al., 1986; Sawai and Kondoh, unpublished It is a widely accepted notion that proto-oncogenes have o b s e r v a t i o n ) . essential regulatory functions in normal ontogenesis. Many The N- m y c protein is usually found in the nucleus of them are expressed primarily in the embryos and are (Ikegaki et al., 1986; Ramsay et al., 1986; Slamon et al., thought to regulate embryogenesis in direct or indirect 1986; Ueno et al., 1988; Kato et al., 1991), and is consid- ways. A straightforward approach to clarify the function of ered to bind to DNA in a sequence-specific manner upon such regulatory genes is to analyze the consequence of hetero-dimerization with a partner protein (Max/Myn), as mutational alteration of the gene in an animal’s life. This demonstrated for the c- m y c protein (Blackwood and Eisen- can be accomplished by gene targeting technology using man, 1991; Prendergast et al., 1991). There is evidence that embryonic stem (ES) cells (Thomas and Capecchi, 1987). c- m y c protein has the capacity to regulate transcription The N- m y c gene is one of the oncogenes whose normal (Kato et al., 1990). Since there is a considerable conser- function is implicated in the regulation of embryogenesis. vation of amino acid sequence motifs among the myc Although recognized by its similarity with the c- m y c g e n e family proteins, especially between N-myc and c-myc, and its amplification in malignant neuroblastomas (Kohl et similarity of their molecular actions as transcriptional reg- al., 1983; Schwab et al., 1983), analysis of normal ulators has been strongly suggested. However, there are N- ontogeny indicated that N- m y c gene is primarily expressed m y c - s p e c i fic domains in the sequence that are conserved in the early part of embryonic development, especially among the animal species (Sawai et al., 1990), indicating during organogenesis (Jakobovitz et al., 1985; Kato et al., activities that are unique to N-myc. Thus, it is a likely 1991). This is in contrast to the expression of c- m y c, which hypothesis that N- m y c protein regulates transcription of a appears to persist throughout an animal’s life. N- m y c a l s o particular group of genes that participate directly in the appears to differ from L- m y c, another member of the myc organogenic process. 1446 S. Sawai and others Involvement of the N- m y c activity in the process of al. (1990) or by use of polymerase chain reaction (PCR) for other organogenesis was even more strongly suggested by his- cases (Fig. 1). The primers used were: tological analyses of N- m y c expression utilizing in situ a, CGGACGAAGATGACTTCTAC; hybridization. During organogenesis of the mouse, N- m y c b, ACATGCAGTCCTGAAGGATG; expression was initially localized in the primitive streak c, GCTTGCCGAATATCATGGTG. (day 7.5), then in the neural fold and presomitic mesoderm Histology (day 8.5; Downs et al., 1989). At day 9.5, N- m y c e x p r e s- Histological sections stained with hematoxylin and eosine were sion was high in the central nervous system, neural crest prepared from Bouin-fixed and paraffin-embedded specimens derivatives, limb bud mesenchyme, myocardium, and a few according to the conventional method. In situ hybridization of N- additional condensed mesoderm derivatives (Kato et al., myc transcripts on paraffin sections (Wakamatsu and Kondoh, 1991). The distribution of N- m y c transcripts in mouse 1990; Kato et al., 1991) and immunofluorescent staining of N- embryos at day 9.5 was highly correlated with that of N- myc and neurofilaments on cryosections (Kato et al., 1991) were m y c protein detected by N-myc-specific antibodies (Kato done as described. et al., 1991), and almost identical to that in 3.5 day chicken embryos (Sawai et al., 1990). During the later period of Organ cultures organogenesis, the expression of N-myc in previously pos- Organ cultures of embryonic lungs and limbs were carrried out itive tissues gradually diminished (Wakamatsu and according to Hirai et al. (1989), except that the culture medium was L-15, the gas phase was the air and fetal calf serum was omit- Kondoh, unpublished observations), and in turn the expres- ted where indicated. sion commenced in endodermal epithelia of the lung (Hirn- ing et al., 1991) and the digestive tract as will be described b e l o w . RESULTS Previously, we reported disruption of N-myc alleles, singly or doubly, in ES cells by insertion of neomycin/ Apparently normal development of N-myc- hygromycin- resistance sequences into the N-myc coding deficient mutant embryos up to day 10.5 region by utilizing homologous recombination (Sawai et al., The previous observations that N-myc deficiency resulted 1991). Unexpectedly, totally N-myc-deficient ES lines made in embryonic lethality but that N-myc activity is dispens- by consecutive gene disruption were normal in cell mor- able in ES cells (Sawai et al., 1991) suggested the require- phology, growth properties and differentiation repertoire ment of N-myc in the postblastocyst periods. Thus, we ana- under culture conditions, indicating the non-essentiality of lyzed the implanted embryos produced from crosses N-myc activity in the ES cells in spite of the high N-myc between the N-myc heterozygous mice. In assessing the expression in normal ES lines (Sawai et al., 1991), a situ- phenotype, the genotype of the embryo was determined ation analogous to the one observed in pim double knock- using yolk sac DNAs, either by Southern blotting or PCR out ES lines (Riele et al., 1990). (Fig. 1), and the embryo proper was analyzed for the phe- However, when disrupted N-myc alleles were transmit- notype. ted to descendants from the primary mouse chimeras made Since the phenotype of N-myc-deficient homozygous between normal blastocysts and the ES cells, and resulting embryos might differ depending on the genetic background heterozygotes were intercrossed, the embryonic death of of the mouse, we crossed the N-myc-heterozygous mice for homozygous N-myc-deficient mice became apparent (Sawai several generations with Balb/c or ICR and made two iso- et al., 1991). We describe here the defects of organogene- lated pedigrees. Then, sibling heterozygotes were mated to sis observed in N-myc-deficient homozygous mutants (here- obtain homozygous embryos. However, since the results on after simply called ‘mutants’) which are highly correlated homozygous embryos were, in fact, the same between with the tissue distribution of N-myc expression during the Balb/c and ICR pedigrees, the data were combined without period from day 9.5 to day 12, and indicate involvement of specifying the genetic background. N-myc in tissue interactions required for normal organo- Among the 9.5 and 10.5 day embryos collected from sev- genesis. The mutant phenotype described here is very dif- eral litters, wild-type, heterozygous and homozygous ferent from that described for very leaky N-myc mutants embryos of the N-myc locus were found in the ratio approx- generated by non-replacement type mutagenesis (Moens imated by the Mendelian 1:2:1, demonstrating the viability et.al., 1992), where the lung was the only organ affected of N-myc-deficient embryos up to these stages (Table 1). during embryogenesis. At day 9.5, homozygous mutants were normal in size, external morphology and development of internal organs (data not shown). N-myc-deficient mutant embryos were MATERIALS AND METHODS also recovered with normal morphology at day 10.5.