Development of Microsatellites from Fothergilla ×intermedia (Hamamelidaceae) and Cross Transfer to Four other Genera within Hamamelidaceae Author(s): E. Anne Hatmaker, Phillip A. Wadl, Kristie Mantooth, Brian E. Scheffler, Bonnie H. Ownley, and Robert N. Trigiano Source: Applications in Plant Sciences, 3(4) Published By: Botanical Society of America DOI: http://dx.doi.org/10.3732/apps.1400123 URL: http://www.bioone.org/doi/full/10.3732/apps.1400123 BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, and environmental sciences. BioOne provides a sustainable online platform for over 170 journals and books published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use. Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. ApApplicatitionsons Applications in Plant Sciences 2015 3 ( 4 ): 1400123 inin PlPlant ScienSciencesces P RIMER NOTE D EVELOPMENT OF MICROSATELLITES FROM F OTHERGILLA × INTERMEDIA (HAMAMELIDACEAE) AND CROSS TRANSFER TO 1 FOUR OTHER GENERA WITHIN HAMAMELIDACEAE E . A NNE H ATMAKER 2,4 , P HILLIP A . W ADL 2,4,5 , K RISTIE M ANTOOTH 2 , B RIAN E. SCHEFFLER 3 , B ONNIE H. OWNLEY 2 , AND R OBERT N . T RIGIANO 2 2 Department of Entomology and Plant Pathology, University of Tennessee, 2505 E. J. Chapman Drive, Knoxville, Tennessee 37996-4560 USA; and 3 USDA-ARS Genomics and Bioinformatics Research Unit, 141 Experiment Station Road, P.O. Box 36, Stoneville, Mississippi 38776-0038 USA • Premise of the study: We developed microsatellites from Fothergilla × intermedia to establish loci capable of distinguishing species and cultivars, and to assess genetic diversity for use by ornamental breeders and to transfer within Hamamelidaceae. • Methods and Results: We sequenced a small insert genomic library enriched for microsatellites to develop 12 polymorphic microsatellite loci. The number of alleles detected ranged from four to 15 across fi ve genera within Hamamelidaceae. Shan- non’s information index ranged from 0.07 to 0.14. • Conclusions: These microsatellite loci provide a set of markers to evaluate genetic diversity of natural and cultivated collec- tions and assist ornamental plant breeders for genetic studies of fi ve popular genera of woody ornamental plants. Key words: Corylopsis ; Hamamelidaceae; Hamamelis ; Loropetalum ; Parrotia ; simple sequence repeats. Hamamelidaceae comprises 31 genera and more than 140 Loropetalum , and Parrotia are native to Asia. Loropetalum chi- species ( Li et al., 1999 ) and includes several ornamental genera nense (R. Br.) Oliv. is found in Japan and southeastern China, within Corylopsis Siebold & Zucc., Fothergilla L., Hamamelis whereas L. lanceum Hand.-Mazz. is more widely distributed L., Loropetalum R. Br., and Parrotia C. A. Mey. Fothergilla throughout Japan, China, and northeastern India ( Zhang et al., has been used in ornamental plantings for over two centuries 2003 ). Only four populations of L. subcordatum (Benth.) Oliv. and there are fewer than 15 cultivars, whereas Loropetalum has remain, making it one of the most endangered angiosperm spe- 19 cultivars and Corylopsis and Parrotia have fi ve or fewer cies in China ( Gong et al., 2010 ). Parrotia persica (DC.) C. A. cultivars ( Dirr, 1998 ). Hamamelis species are used as an astrin- Mey. is a deciduous tree endemic to northern Iran; it is the only gent and are more widely recognized, with more than 75 culti- extant species in the genus and could become a conservation vars ( Marquard et al., 1997 ). Many cultivars from these genera concern if habitat destruction continues ( Sefi di et al., 2011 ). are commercially available, but the pedigrees are not well Species from the genus Hamamelis are found on both the North known as they are often selected from spontaneous mutations, American and Asian continents ( Zhang et al., 2003 ). Fother- wild-grown seedlings, or open-pollinated crosses, as is the case gilla is the only genus exclusively limited to North America. with Hamamelis ( Marquard et al., 1997 ). The genus is found in the southeastern United States and in- The phylogeny of Hamamelidaceae has been examined and, cludes only two species, F. major Lodd. and F. gardenia L., as based on nrDNA ITS sequences, a well-supported phylogeny well as the hybrid Fothergilla × intermedia . Both species are of with three clades was resolved ( Li et al., 1999 ). Fothergilla , conservation concern, F. major in Tennessee and F. gardenii in Hamamelis , and Parrotia were in one clade, whereas Cory- both Florida and Georgia ( USDA, 2012 ). lopsis and Loropetalum were in a different clade. Corylopsis , Molecular markers can be used to determine diversity in wild populations and assist in breeding and conservation studies. The purpose of this study was to develop a microsatellite- enriched library from Fothergilla × intermedia to establish loci 1 Manuscript received 29 December 2014; revision accepted 5 March 2015. capable of distinguishing species and cultivars, to assess ge- This study was supported by the United States Department of Agriculture netic diversity for use by ornamental breeders, and to test these (grant no. 58-6404-1637). Mention of commercial products in this article loci for crossover to other members of Hamamelidaceae, such is solely for the purpose of providing specifi c information and does not as those in the related genera Corylopsis , Hamamelis , Loro- imply recommendation by The University of Tennessee or the United petalum , and Parrotia . States Department of Agriculture. We thank the J. C. Raulston Arboretum at North Carolina State University, Spring Grove Cemetery and Arboretum, and the Arnold Arboretum of Harvard University for plant tissue. 4 These authors contributed equally to this work. METHODS AND RESULTS 5 Author for correspondence: [email protected] Leaf tissue or unopened fl ower buds were obtained from the J. C. Raulston doi:10.3732/apps.1400123 Arboretum at North Carolina State University (Raleigh, North Carolina, USA), Applications in Plant Sciences 2015 3 ( 4 ): 1400123; http://www.bioone.org/loi/apps © 2015 Hatmaker et al. Published by the Botanical Society of America. This article is a U.S. Government work and is in the public domain in the USA. 1 of 4 Applications in Plant Sciences 2015 3 ( 4 ): 1400123 Hatmaker et al.— Fothergilla microsatellites doi:10.3732/apps.1400123 T ABLE 1. Characteristics of 12 microsatellite loci isolated from Fothergilla × intermedia for three Corylopsis , 15 Fothergilla , 14 Hamamelis , two Loropetalum , and two Parrotia accessions. a Allele size Shannon’s GenBank Locus Primer sequences (5 ′ –3 ′ ) Repeat motif range (bp)A information index accession no. Foth001F: ATCCTAAAGAGCGGTCAGATTG (AC)10 152–198 12 0.14 KJ461123 R: ATGATTCGAAACTGACAATCCA Foth002F: GCAGCAATAGCCAAAATTATCC T(AC)4 AT(AC)8 (AT)5 180–207 11 0.11 KJ461124 R: GGTTTCGTTGAGTTTTGAATGA Foth004F: TCTTCAATTTTCTCAGCAATCAA (AC) 6 (AT)5 143–177 14 0.11 KJ461125 R: AACTCAAGGGAAAAACCCTAAGA Foth009F: CGGATTAGAAGTTGTAAAATTTTGGT (TC)5 (TCTTTTTCTC)2 159–226 9 0.13 KJ461126 R: GTCGACGTAGACATACCTGCAA Foth016F: ACAGAAAGAAGAAAACCCCACA (AC)15 158–207 15 0.11 KJ461127 R: GTGACTCTGGATTTGCCCATA Foth018F: TCTTCTTCAGGAGTCCATAGCC (GT)17 (GA)15 163–208 14 0.11 KJ461128 R: ACTCTTTCCCATCTCTCCGATT Foth021F: AACTTATTTGGATTTTGGTTTTTGA (TG)9 CGA(GT)7 114–163 8 0.11 KJ461129 R: CAAACTCAAAAATAGATGGGTTTTC Foth027F: TTTGAAGTCTTTATAGGGAAGAGC (TG)12 111–138 9 0.12 KJ461130 R: CAAAAATTTTATCAAATGAAATGCAC Foth029F: AAGGGTTTTGTAAAATGGTCTCA (CA)6 CC(CA)5 156–159 4 0.07 KJ461131 R: TAACAGATGAATCCACCTTAGCC Foth032F: CAACCAGGCTACTACCAAATTCA (CA)7 CG(CA)6 128–209 14 0.11 KJ461132 R: CGGTGGACATTACATGATGATAG Foth040F: TCAAAATACTATCGGCTGTGTGA (TG)13 147–177 9 0.10 KJ461133 R: ATGCGAGGTATTAGAATTGGACA Foth045F: TCTTCTTCTGTGGCTAAGTGGAG (TG)13 175–211 9 0.09 KJ461134 R: TATTTGAATGCCCATTATCCATT Note : A = number of alleles . a Optimum annealing temperature was 55 ° C. Spring Grove Cemetery and Arboretum (Cincinnati, Ohio, USA), Arnold SSR Finder ( Stieneke and Eujayl, 2007 ). Primer3 ( Rozen and Skaletsky, Arboretum of Harvard University (Boston, Massachusetts, USA), and Uni- 1999 ) was used to design 50 primer pairs, which were screened for amplifi - versity of Tennessee Gardens (Knoxville, Tennessee, USA). Approximately cation against a subset of four Fothergilla samples. A single 10- μ L PCR reac- × 100 mg of tissue was homogenized in 2.0-mL microcentrifuge tubes (Fisher tion contained 10 ng DNA, 2.5 mM MgCl2 , 1 GeneAmp PCR Buffer II Scientifi c, Pittsburgh, Pennsylvania, USA) containing silica beads (2.3 mm; (Applied Biosystems, Carlsbad, California, USA), 0.2 mM dNTPs, 0.25 μ M BioSpec Products, Bartlesville, Oklahoma, USA) and frozen in liquid nitro- primers (forward and reverse), 5% dimethyl sulfi de (DMSO; Fisher Scien- gen for 5 min followed by agitation in a Bio101 FastPrep Homogenization tifi c), 0.4 unit AmpliTaq Gold DNA Polymerase (Applied Biosystems), and System FP120 (Thermo Savant, Waltham, Massachusetts,