(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2019/089982 Al 09 May 2019 (09.05.2019) W 1P O PCT (51) International Patent Classification: (71) Applicant: JUNO THERAPEUTICS, INC. [US/US]; 400 C12Q 1/6897 (2018.01) CI2N 15/65 (2006.01) Dexter Avenue N, Suite 1200, Seattle, Washington 98109 C12Q 1/02 (2006.01) G01N 33/50 (2006.01) (US). C12N 5/0783 (2010.01) (72) Inventors: AMIN, Rupesh; 400 Dexter Avenue N., Suite (21) International Application Number: 1200, Seattle, Washington 98109 (US). CHEN, Aye; 400 PCT/US20 18/058781 Dexter Avenue N., Suite 1200, Seattle, Washington 98109 (US). (22) International Filing Date: 0 1 November 2018 (01. 11.2018) (74) Agent: AHN, Sejin et al.; Morrison & Foerster LLP, 1253 1 High Bluff Drive, Suite 100, San Diego, California (25) Filing Language: English 92130-2040 (US). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 62/580,405 0 1 November 2017 (01. 11.2017) US AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, 62/596,758 08 December 2017 (08. 12.2017) US CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, 62/599,672 15 December 2017 (15. 12.2017) US DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, (54) Title: METHOD OF ASSESSING ACTIVITY OF RECOMBINANT ANTIGEN RECEPTORS FIG. 2D s 8 o T E β BCMA-Fc (Mg/mL) (57) Abstract: Reporter T-cell in which the reporter is operably linked to the Nur77 locus. Methods for screening for the activity of a recombinant receptor, including recombinant receptors containing an extracellular antigen-binding domain and an intracellular signaling 00 domain, such as a chimeric antigen receptor (CAR). The methods include assessing activity of a cell expressing the recombinant receptor based on a detectable expression of a reporter molecule that is responsive to a signal through the intracellular signaling region of 0 the recombinant receptor. In some embodiments, the activity assessed is an antigen- dependent or an antigen-independent activity. In © some embodiments, the methods can be used to screen a plurality of reporter cells each containing a nucleic acid molecule encoding a candidate recombinant receptor, e.g. CAR, and assessing such cells or plurality of cells for one or more property or activity. The o methods can be high- throughput. Also provided are reporter cells, cell compositions, nucleic acids and kits for use in the methods. o [Continued on nextpage] W O 2019/089982 A l Illlll II lllll lllll lllll llll III III lllll lllll lllll lllll lllll llll llll llll llll KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY,MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (84) Designated States (unless otherwise indicated, for every kind of regional protection available) : ARJPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). Declarations under Rule 4.17: — as to the applicant's entitlement to claim the priority of the earlier application (Rule 4.17(in)) Published: — with international search report (Art. 21(3)) — before the expiration of the time limit for amending the claims and to be republished in the event of receipt of amendments (Rule 48.2(h)) — with sequence listing part of description (Rule 5.2(a)) METHOD OF ASSESSING ACTIVITY OF RECOMBINANT ANTIGEN RECEPTORS Cross-Reference to Related Applications [0001] This application claims priority from U.S. provisional application No. 62/580,405, filed November 1, 2017, entitled "METHOD OF ASSESSING ACTIVITY OF RECOMBINANT ANTIGEN RECEPTORS," U.S. provisional application No. 62/596,758, filed December 8, 2017, entitled "METHOD OF ASSESSING ACTIVITY OF RECOMBINANT ANTIGEN RECEPTORS," and U.S. provisional application No. 62/599,672, filed December 15, 2017, entitled "METHOD OF ASSESSING ACTIVITY OF RECOMBINANT ANTIGEN RECEPTORS," the contents of which are incorporated by reference in their entirety. Incorporation by Reference of Sequence Listing [0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 735042007440SeqList.txt, created October 31, 2018, which is 82 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety. Field [0003] The present disclosure relates to a method for screening for one or more activity of a recombinant receptor, including recombinant receptors that contain an extracellular antigen- binding domain and an intracellular singaling domain, such as a chimeric antigen receptor (CAR). The methods include assessing or determining activity of a cell expressing the recombinant receptor based on a detectable or measurable expression of a reporter molecule that is responsive to a signal through the intracellular signaling region of the recombinant receptor. In some embodiments, the activity assessed is an antigen-dependent or an antigen-independent activity. In some embodiments, the methods can be used to screen a plurality of reporter cells each containing a nucleic acid molecule encoding a candidate recombinant receptor, e.g. CAR, and assessing such cells or plurality of cells for one or more property or activity. The methods can be high-throughput. Also provided are reporter cells, such as reporter T cells, cell compositions, nucleic acids and kits for use in the methods. Background [0004] Adoptive cell therapies that utilize recombinantly expressed antigen receptors (e.g. chimeric antigen receptors (CARs)) to recognize tumor antigens represent an attractive therapeutic modality for the treatment of cancers and other diseases. Improved strategies are needed to identify CARs that have particular properties or activities, such as properties and activities suited for use as therapeutic molecules, including in connection with adoptive immunotherapy, for use in treating cancer, infectious diseases and autoimmune diseases. Provided are methods, cells, and nucleic acids, e.g., vectors, and compositions and/or a plurality of cells or nucleic acids, e.g., vectors, for use in the methods that meet such needs. Summary [0005] Provided in some aspects are reporter T cells containing a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element or a variant thereof, of a Nur77, wherein the transcriptional regulatory element optionally is a transcriptional regulatory element within an endogenous Nur77 locus in the T cell. Provided in some aspects are reporter T cells containing a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of the endogenous locus encoding Nur77. In some embodiments, the reporter T cell further contains a recombinant receptor comprising an intracellular signaling region, optionally a chimeric antigen receptor (CAR). In some embodiments, the transcriptional regulatory element is a promoter, an enhancer or a response element or a portion thereof. [0006] In some embodiments, the reporter T cell includes a nucleic acid sequence encoding a reporter molecule operably linked to a transcriptional regulatory element of the endogenous locus encoding Nur77. In some embodiments, the reporter T cell further contains a recombinant receptor comprising an intracellular signaling region, optionally a chimeric antigen receptor (CAR). In some embodiments, the transcriptional regulatory element is a promoter, an enhancer or a response element or a portion thereof. In some embodiments, the nucleic acid sequence encoding the reporter molecule is present within the genome of the cell or integrated at or near the endogenous locus encoding Nur77. [0007] In some embodiments, provided herein are reporter T cells wherein the nucleic acid sequence encoding the reporter molecule is integrated or is targeted for integration by a) inducing a genetic disruption at one or more target site(s) at or near the endogenous locus encoding Nur77; and b) introducing a template polynucleotide for homology directed repair (HDR). In some embodiments, the genetic disruption is induced by a DNA binding protein or DNA-binding nucleic acid that specifically binds to or hybridizes to the target site, optionally a fusion protein containing a DNA-targeting protein and a nuclease or an RNA-guided nuclease. In some embodiments, the fusion protein containing a DNA-targeting protein and a nuclease or the RNA-guided nuclease is or includes a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas9 combination that specifically binds to, recognizes, or hybridizes to the target site. In some embodiments, the RNA-guided nuclease includes a guide RNA (gRNA) having a targeting domain that is complementary to the target site. [0008] In some embodiments of any of the reporter T cells described herein, the nucleic acid encoding the reporter is present within the genome at a site that is at or near the final exon of the endogenous locus encoding Nur77. In some embodiments, the one or more target site(s) comprise, and/or the nucleic acid is present within the genome at a site comprising, the nucleic acid sequence TCATTGACAAGATCTTCATG (SEQ ID NO:65) and/or GCCTGGGAACACGTGTGCA (SEQ ID NO:66).