Molecular Vision 4: 8, 1998 <http://www.molvis.org/molvis/v4/p8> © Molecular Vision Received 16 Apr 1998 | Accepted 22 Apr 1998 | Published 30 Apr 1998 Cloning and Mapping the Mouse Crygs Gene and Non-lens Expression of γS-Crystallin Debasish Sinha,1 Noriko Esumi,1 Cynthia Jaworski,1 Christine A. Kozak,2 Eric Pierce,3 and Graeme Wistow1,* 1Section on Molecular Structure and Function, National Eye Institute, National Institutes of Health, Bethesda, MD; 2Labora- tory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD; 3Department of Ophthalmology, Harvard Medical School and Children’s Hospital, Boston, MA Purpose: γ-Crystallins are major structural proteins of the eye lens. While other crystallins have revealed distinct non-lens functions and patterns of expression, γ-crystallins have generally appeared to be the most lens-specific of the crystallins. Here we examine the mouse γS-crystallin (γS) gene and its expression. Methods: The cDNA and gene for mouse γS were cloned and sequenced. The Crygs gene was mapped using genetic crosses. Expression patterns in mouse and cow were examined by northern blot, PCR and western blot using a specific peptide antibody. Results: The Crygs gene was sequenced and mapped to mouse chromosome 16, at or near the locus for the genetic cataract Opj. Northern blots of tissues from new born mice, showed lens specific expression of γS. However, in the mature mouse eye there was, in addition, clear non-lens expression of γS. In the adult bovine eye RT-PCR shows that γS is expressed in lens, retina and cornea. A peptide antibody directed against γS detects bands of the expected size in western blots of mouse lens and in 33 day old mouse retina. Conclusions: These results suggest that γ-crystallins have a non-crystallin role outside the lens, one which may predate the lens in evolutionary terms. Non-lens expression seems to increase with age in young mice, hinting that γS may have a role similar to that of a stress protein in tissues of the eye, perhaps related to accumulating insults resulting from light exposure. The optical and structural properties of the lens are largely larval stages [11], but this expression could represent “leakage” determined by the expression of very high levels of several during early development; no evidence has been presented for classes of soluble proteins, the crystallins [1-4]. It is now clear functional expression at the level of protein. that crystallins arose from proteins with pre-existing functions In mammals there are six γ-crystallin genes (called γA-F which underwent direct gene recruitment to acquire additional in most species) that are highly similar to each other and closely roles as structural proteins in the lens [3-5]. In many species, clustered in the genome. These six genes are expressed mainly the composition of the lens has been modified by relatively during embryonic lens development [4,12,13] and are specific recent events involving the gene recruitment of enzymes as to the fiber cells, the most specialized, terminally differentiated taxon-specific crystallins [3,4]. In contrast, the α, β, and γ lens cells. As the lens grows throughout life, the cells families are ubiquitously represented in all vertebrates and must containing γ-crystallins form the lens nucleus, the most central have been recruited to the evolving lens in an early common part of the lens with the highest protein concentration and ancestor of modern vertebrate species [3,4]. The α-crystallins highest refractive index. Indeed, γ-crystallin expression is clearly arose from the small heat shock protein superfamily generally associated with the most densely packed lenses and and, in mammals, αB-crystallin is expressed as a stress protein regions of lenses. γ-Crystallins are highly abundant in the very [6,7]. The β- and γ-crystallins are evolutionarily and hard lenses of fish and many rodents while γA-F are absent structurally related members of a βγ superfamily [8], which from birds, which have very soft, highly accommodating lenses also includes micro-organism stress proteins as well as [4,12,14]. vertebrate proteins that appear to be associated with processes However, in addition to the γA-F genes, all vertebrates of cell differentiation and morphological change [4,9]. It has contain another member of the family that is well-conserved been shown that in addition to their expression in lens, β- in sequence from fish to mammals and birds [15-18]. Formerly crystallins are widely expressed in other tissues at lower levels known as βs-crystallin, γS-crystallin (γS) was renamed when [10], although their non-lens function is unknown. Currently, the structure of the bovine gene was determined and proved γ-crystallins appear to be the most lens-specific and specialized to be characteristic of the γ rather than the β family [18]. In of the crystallins. γ-Crystallin gene transcripts have been contrast to other γ-crystallins, γS expression increases to high detected by sensitive methods outside the lens in amphibian levels only late in lens development and γS appears to replace the embryonic γ-crystallins in the secondary fiber cells of the * To whom correspondence should be addressed: Graeme Wistow, adult lens [2,19]. In sequence, γS is an outlier of the γ family Ph.D. Chief, Section on Molecular Structure and Function, National and possesses a short N-terminal arm and a blocked N-terminus Eye Institute, Building 6 Room 331, National Institutes of Health, [16,18], characteristics more typical of β-crystallins. In many Bethesda, MD, 20892-2740, USA; Phone: (301) 402-3452; Fax: (301) γ 496-0078; email: [email protected] ways, S is a good candidate to represent the precursor of the Dr. Esumi is now at the Wilmer Ophthalmological Institute, Johns γ-crystallins and possibly a link between the β- and γ-families. Hopkins Hospital, Baltimore, MD. As such, γS might be expected to be the member of the family Molecular Vision 4: 8, 1998 <http://www.molvis.org/molvis/v4/p8> © Molecular Vision most likely to retain a non-lens function distinct from the bulk 320 bp mouse γS cDNA probe was labeled by random priming role as crystallin. Here we examine the gene sequence and and hybridization was carried out at 65 ΟC. expression of mouse γS (Crygs) and find evidence for Chromosomal localization— Crygs was mapped by expression outside the lens, particularly in mature retina and analysis of two genetic crosses: (NFS/N or C58/J X M. m. cornea. musculus) X M. m. musculus [22] and (NFS/N X M. spretus) X M. spretus or C58/J [23]. Progeny of these crosses have METHODS been typed for over 1200 markers distributed on all 19 cDNA and Gene Cloning and Sequencing— cDNA cloning autosomes and the X chromosome. Recombination was was performed using polymerase chain reaction (PCR) calculated according to Green [24], and genes were ordered techniques. Primers were designed from the published bovine by minimizing the number of recombinants. γS sequence (GenBank accession number X03006) [18] and Northern Analysis of Mouse Tissues— Total RNA was were used for 5' and 3' RACE [20]. For RACE, 1 µg of adult extracted from dissected 2 day, 8.5 week, and 10 month old mouse lens total RNA was transcribed with the appropriate mouse tissues using RNA STAT-60 (Tel-Test Inc., primer using Superscript RT (Life Technologies, Gaithersburg, Friendswood, TX). Northern blotting followed standard MD) following the manufacturer’s protocols. Ten percent of methods [21], with 20 µg of total RNA loaded per lane on a the resulting cDNA template then was used for PCR 1.5% agarose gel, using formaldehyde buffer. A 320 bp mouse amplification with Taq polymerase (Boehringer Mannheim, Indianapolis, IN) with 30 cycles of 94 ΟC for 1 min, 60 ΟC for A 1 min, and 72 ΟC for 1 min, finishing with a final 10 min extension at 72 ΟC. Magnesium concentrations were optimized for each reaction. For 3' RACE, oligo(dT) and γS-specific primers were used. For 5' RACE, γS-specific primers were used for first strand synthesis and cDNA was G-tailed using terminal transferase. Reagents for RACE were taken from the Life Technologies 5' RACE system kit, following the manufacturer’s instructions. Primer sequences are available on request. PCR fragments were sequenced directly using the PRISM dye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) and AmpliTaq polymerase FS (Perkin Elmer, Norwalk, CT), following manufacturers’ protocols. To identify the mouse γS gene, two primers GSG1: GGTCAGATGTACGAAACCACGGAAGACTGT and GSG2:CAATGCTTTTATTTACGTTGTCTATTTGGAC, designed from the cDNA sequence, were used to amplify a γS genomic fragment predicted to contain intron 2. These were tested on mouse genomic DNA and then supplied to Genome Systems, Inc. (St. Louis, MO) to identify P1 clones from 129/ B svJ strain mouse genomic DNA. A clone was obtained and PCR, using primer pairs specific to 5' and 3' ends of the gene transcript, was used to ensure that the complete gene was present. Fragments of the gene were amplified from the P1 clone by PCR using primers from the cDNA sequence. These were gel purified and used as direct sequencing templates as described above. Flanking sequences were obtained by cycle sequencing of the P1 clone itself. New primers were designed as needed to walk through the sequence. Primer sequences γ are available on request. Introns were amplified using primers Figure 1. The Mouse -crystallin family. A. Alignment of protein sequences for the complete mouse γ-crystallin family, including γS. in the flanking exons. For intron 1, long range PCR was Identity with γA is shown by a dot, gaps are shown by dashes.