Cancer Gene Therapy (2013) 20, 94–100 & 2013 Nature America, Inc. All rights reserved 0929-1903/13 www.nature.com/cgt ORIGINAL ARTICLE Transforming growth factor-b gene silencing using adenovirus expressing TGF-b1 or TGF-b2 shRNA SOh1,2, E Kim1,2, D Kang1,3, M Kim1, J-H Kim4 and JJ Song1 Tumor cells secrete a variety of cytokines to outgrow and evade host immune surveillance. In this context, transforming growth factor-b1 (TGF-b1) is an extremely interesting cytokine because it has biphasic effects in cancer cells and normal cells. TGF-b1 acts as a growth inhibitor in normal cells, whereas it promotes tumor growth and progression in tumor cells. Overexpression of TGF-b1 in tumor cells also provides additional oncogenic activities by circumventing the host immune surveillance. Therefore, this study ultimately aimed to test the hypothesis that suppression of TGF-b1 in tumor cells by RNA interference can have antitumorigenic effects. However, we demonstrated here that the interrelation between TGF-b isotypes should be carefully considered for the antitumor effect in addition to the selection of target sequences with highest efficacy. The target sequences were proven to be highly specific and effective for suppressing both TGF-b1 mRNA and protein expression in cells after infection with an adenovirus expressing TGF-b1 short hairpin RNA (shRNA). A single base pair change in the shRNA sequence completely abrogated the suppressive effect on TGF-b1. Surprisingly, the suppression of TGF-b1 induced TGF-b3 upregulation, and the suppression of TGF-b2 induced another unexpected downregulation of both TGF-b1 and TGF-b3. Taken together, this information may prove useful when considering the design for a novel cancer immunogene therapy. Cancer Gene Therapy (2013) 20, 94–100; doi:10.1038/cgt.2012.90; published online 11 January 2013 Keywords: TGF-b isotype; shRNA; adenovirus; antitumor; immunosuppression INTRODUCTION homology-dependent degradation of the target mRNA.15,16 In Transforming growth factor (TGF)-b is a homodimeric protein that mammalian cells, small interfering RNAs (siRNAs) are produced has three different isoforms (TGF-b1, TGF-b2 and TGF-b3), which through cleavage of longer double-stranded RNA precursors by 17,18 have both overlapping and distinct functions.1,2 These isoforms the RNaseIII endonuclease dicer. After dicer processing, the are secreted as latent 25 kDa active homodimer complexes that 21–23 nucleotide siRNA is incorporated into a protein complex 19 bind TGF-b receptors to initiate intracellular signaling.3 Because called RNA-induced silencing complex. Argonaute 2, a multi- various oncogenic pathways directly inactivate the TGF-b functional protein contained within RNA-induced silencing receptor-Smad pathway, which inhibits proliferation and induces complex, cleaves and releases the sense strand (passenger apoptosis, tumor cells can use TGF-b for their advantage to initiate strand), thereby activating RNA-induced silencing complex with 16,17 immune evasion, growth factor production and metastasis.4,5 All a single-stranded antisense strand (guide strand) that human tumors overexpress TGF-b and accordingly induce tumor selectively degrades complementary mRNA. cell invasion and metastasis.5 The TGF-b isoforms contribute to a Because of the efficacy and specificity of siRNA, it is emerging 20 number of cellular activities like inhibiting normal epithelial cell as a potential new basis for the treatment of human diseases. proliferation while inducing cancer cell proliferation, and However, one of the main drawbacks in the development of promoting an invasive phenotype that is characterized by siRNA therapy is the instability of siRNA in vivo. To overcome epithelial-to-mesenchymal transition.6 Another major role of this instability, DNA-based RNA interference drugs that utilize a TGF-b that is produced by tumors is to block the immune vector delivery system are being developed. For the expression response.7 The local immunosuppressive environment of the of siRNA in cells, short hairpin RNAs (shRNAs) are annealed tumor induced by TGF-b has proved to be the major obstacle to to the vector system and processed into siRNAs by dicer after 16 immunogene therapy with cytokines.8 Among the three isoforms introduction into the cell. Here, we used adenovirus as a delivery of TGF-b, TGF-b1 is the most abundant, universally expressed,7,9 vector for TGF-b shRNA. Adenoviral vectors are still frequently and when silenced, increases antitumor immunity.10,11 In addition used as a method of gene transfer because of efficient transgene to the effect on immunosuppression, TGF-b1 silencing also delivery, expression in both dividing and non-dividing cells and efficiently inhibits proliferation and migration.2 Recently, TGF-b1 ease of propagation to high titers in spite of shortcomings like has also been reported to suppress apoptosis.12–14 increased immunogenicity, the prevalence of pre-existing anti- RNA interference is a regulatory mechanism of most adenovirus immunity in the human population and the inability to 21,22 eukaryotic cells that uses small double-stranded RNA to direct specific targeting. 1Institute for Cancer Research, College of Medicine, Yonsei University, Seoul, South Korea; 2Brain Korea 21 Project for Medical Science, College of Medicine, Yonsei University, Seoul, South Korea; 3Department of Oncology, Affiliated Hospital of Yanbian University, Yanji, Jilin Province, People’s Republic of China and 4Department of Internal Medicine, College of Medicine, Yonsei University, Seoul, South Korea. Correspondence: Professor J-H Kim, Department of Internal Medicine, College of Medicine, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul, South Korea. or Professor JJ Song, Institute for Cancer Research, College of Medicine, Yonsei University, 50 Yonsei-ro, Seodaemun-gu, Seoul, South Korea. E-mail: [email protected] or [email protected] Received 14 August 2012; revised 23 November 2012; accepted 30 November 2012; published online 11 January 2013 Target specificity and interrelation between TGF-b isotypes SOhet al 95 MATERIALS AND METHODS TCTCTTGAGAATCTGATATAGCTCAATCCTTTTA-30 and the bottom strand Cell culture sequence 50-AGCTTAAAAGGATTGAGCTATATCAGATTCTCAAGAGATTGAG AATCTGATATAGCTCAATCCG-30 was selected and annealed for subcloning The human cancer cell lines, DU145 (human prostate adenocarcinoma) into pSP72DE3-U6. and A375 (human skin melanoma), were cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum (HyClone, Logan, UT, USA). B16BL6 and B16F10 (mouse melanoma) cells were also cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum Recombinant adenovirus (HyClone). HeLa (human cervix adenocarcinoma) cells were cultured in First, an adenovirus containing the green fluorescence protein (GFP) or minimal essential medium with 10% fetal bovine serum. Cells were LacZ gene was constructed to examine the infection efficiency. In the case maintained in a 37 1C humidified atmosphere containing 5% CO2. of GFP, two different adenoviruses with the GFP gene in either the E1 or E3 region were produced. For the insertion of the GFP gene at the E1 region, pCA14 was used as a shuttle vector. After digestion of pEGFPN1 E1 Reagents (Clontech, Mountainview, CA, USA) with XhoI/XbaI, the insert was Trizol was purchased from Life Technologies (Carlsbad, CA, USA). All other subcloned into XhoI/XbaI-digested pCA14. For the insertion of the GFP chemicals were purchased from Sigma-Aldrich (St, Louis, MO, USA). gene at the E3 region, pSP72DE3 was used as a shuttle vector. After pSP72DE3 was digested with KpnI, the ends were blunted with a Quick blunting kit (New England Biolabs, Ipswich, MA, USA) and further digested Construction of TGF-b shRNAs with BamHI, generating a linearized vector with one cohesive end. For the To construct human TGF-b1 (hTGF-b1) shRNA, we screened three insertion of GFP, pEGFN1 was predigested with AflII, blunted, and then candidate sequences. The selected target sequence was 50-ACCAGAAATAC digested with BamHI to insert the linearized pSP72DE3. For the expression AGCAACAATTCCTG-30, and the loop sequence was 50-TCTCTC-30. Target of LacZ, the LacZ gene was removed from pcDNA3.1/hygro/LacZ selection was performed using an algorithm developed by Genolution (Invitrogen, Carlsbad, CA, USA) by digestion with BamH/XbaI. Thereafter, Pharmaceuticals Inc. (Seoul, South Korea). For expression of hTGF-b1 it was inserted into linearized pCA14 with BamH/XbaI. Finally, pCA14-LacZ shRNA in adenovirus, the top strand sequence was 50-GATCCGCCAGA and pCA14-GFP were recombined into the dl324 adenoviral vector and AATACAGCAACAATTCCTGTCTCTCCAGGAATTGTTGCTGTATTTCTGGTTTTTTT pSP72-GFP was recombined into the dl324-IX adenoviral vector by A-30 and the bottom strand sequence was 50-AGCTTAAAAAAACCAGAAA homologous recombination in BJ5183 bacterial-competent cells, generat- TACAGCAACAATTCCTGGAGAGACAGGAATTGTTGCTGTATTTCTGGTG-30 was ing three different replication-defective adenoviruses to be used as control selected and annealed for subcloning into pSP72DE3-U6. To construct viruses. mouse TGF-b1 (mTGF-b1) shRNA, we screened 11 candidate sequences. The adenoviral shuttle vector, pCA14 (Microbix, Mississauga, ON, The selected target sequence was 50-CCCTCTACAACCAACACAACCCGGG-30 Canada), containing the IX gene of adenovirus type 5, was linearized by and the loop sequence was 50-TCTCTC-30. For expression of mTGF-b1 XmnI digestion. The adenovirus vector dl324-BstBI containing the Ad5 shRNA in adenovirus, the top strand sequence was 50-GATCGCCTCT genome