View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ORIGINAL ARTICLE p63 and p73 Isoform Expression in Non-small Cell Lung Cancer and Corresponding Morphological Normal Lung Tissue Marco Lo Iacono, PhD, Valentina Monica, MS, Silvia Saviozzi, PhD, Paolo Ceppi, MS, Enrico Bracco, PhD, Mauro Papotti, MD, and Giorgio V. Scagliotti, MD he tumor suppressor p53 is a key transcription factor Background: The TP73 and TP63 genes are members of the p53 regulating the expression of genes influencing cell senes- tumor suppressor family and are expressed in different N-terminal T cence, proliferation, apoptosis, and differentiation. The TP73 isoforms either with proapoptotic (transactivation domain, TA) and and TP63 genes are members of the p53 tumor suppressor antiapoptotic (N-terminally truncated, ⌬N) function. Unlike p53, the family, based on substantial structural and functional homol- role of p73 and p63 in tumor is controversial. It has been recently ogies. Unlike p53, that is a tumor suppressor, the role of p73 hypothesized that altered ⌬N:TA expression ratio, rather than single and p63 in tumor is controversial because of their genomic isoform overexpression, plays a role in the pathogenesis of many locus complexity. Through either alternative exon splicing, or diseases, including lung cancer. a second promoter, TP73 and TP63 genes generate several N- Methods: Isoform-specific, real-time polymerase chain reaction and and C-terminal isoforms. The N-terminal isoforms can be immunohistochemistry analysis on matched cancer and correspond- clustered into two groups: the transactivation competent TA ing normal tissues from surgically resected non-small cell lung proteins (TAp63 and TAp73) and the transactivation-defec- cancers (NSCLCs) have been performed aiming to explore the tive, N-terminally truncated ⌬N proteins (⌬Np63, ⌬NЈp73, expression levels of each p63 and p73 N-terminal isoforms and their ⌬2p73, ⌬2/3p73, and ⌬Np73).1 TAp63 and TAp73, and p53, ⌬N:TA expression ratio. transactivate genes that promote either cell cycle arrest or Results: For both p63 and p73, a N-terminal isoform-specific apoptosis.2,3 Conversely, ⌬N isoforms act as dominant negative modulation that alter ⌬N:TA isoform balance was identified. In inhibitors of TA counterparts and p53 functions and in turn particular, ⌬Np63 isoform was significantly up-modulated, whereas hamper apoptosis.2,3 Different p63 and p73 N-terminal isoform TAp63 was slightly down-modulated in NSCLC specimens. Like- expression ratio triggers proproliferative and antiproliferative wise, ⌬2p73 and ⌬2/3p73 were up-modulated, whereas ⌬Np73 and ⌬ Ј signals important for cell fate and normal cell cycling, senes- N p73 isoforms were down-modulated. Moreover, a higher TAp63 cence, or apoptosis decision making. Therefore, these regula- and ⌬NЈp73 transcripts expression, detected in the normal tissue tions could be affected on neoplastic transformation.4 surrounding the tumors, correlates with poor patient outcome, rep- Mutations within the p53 gene are the most common resenting independent prognostic factors for overall survival genetic alterations present in lung cancer. Approximately (⌬NЈp73: p ϭ 0.049, hazard ratio ϭ 3.091, 95% confidence inter- ϭ ϭ ϭ 70% of small cell lung cancer cell lines and 50% of non-small val 1.005–9.524 and TAp63: p 0.001, hazard ratio 8.091, 5 ϭ cell lung cancer (NSCLC) cell lines harbor p53 mutations. In 95% confidence interval 2.254–29.05). 2,6,7 ⌬ contrast, p63 and p73 mutations occur rarely in cancer, Conclusion: Our findings suggest that p63 and p73 altered N:TA supporting the recent hypothesis that altered ⌬N:TA expres- expression ratio occurs in NSCLC likely contributing to the molec- sion ratio, rather than gene mutations, plays a role in cancer ular pathogenesis of this tumor. pathogenesis. Gene expression de-regulation of both p63 and Key Words: p63, p73, Isoform, Quantitative PCR, Immunohisto- p73 N-terminal isoforms is commonly observed in bladder, chemistry, Molecular marker, Non-small cell lung cancer. ovarian, breast, and colon cancers.8–11 In NSCLC, ⌬Np73 protein expression correlates with poor prognosis.12 ⌬Np63␣ (J Thorac Oncol. 2011;6: 473–481) overexpression, both at protein and messenger RNA (mRNA) levels, has been frequently reported to be associated with Department of Clinical and Biological Sciences, University of Turin, Turin, squamous histotype.13,14 Moreover, TAp73 up-modulation Italy. Disclosure: The authors declare no conflicts of interest. has been reported after cell exposure to a large variety of Address for correspondence: Marco Lo Iacono, PhD, Department of Clinical chemotherapeutic agents, and if its activity is blocked, an and Biological Sciences, University of Turin, S.Luigi Hospital, Regione enhancement of chemoresistance is observed.15 In this article, Gonzole 10, 10043 Orbassano, Turin, Italy. E-mail: marco.loiacono@ we report quantitative evaluation of N-terminal p63 and p73 unito.it isoforms in tumor tissues and corresponding morphological Copyright © 2011 by the International Association for the Study of Lung Cancer normal tissues, obtained from the same resected lobe in ISSN: 1556-0864/11/0603-0473 patients with early stage NSCLC. Journal of Thoracic Oncology • Volume 6, Number 3, March 2011 473 Lo Iacono et al. Journal of Thoracic Oncology • Volume 6, Number 3, March 2011 PATIENTS AND METHODS TAp73.RW:GTCGAAGTAGGTGCTGTCTGGTT, Dex2p73 FW:GCTGCGACGGCTGCAGGG, Dex2p73.RW:TTCCGCCC- Patients and Samples ACCACCTCATTATTC, Dex2/ex3p73.FW:CGATGCCCGGG- Primary tumor and paired corresponding normal lung GCT, Dex2/ex3p73.RW:GCGCGGCTGCTCATCT, DNp73.FW: specimens of 46 consecutive NSCLC patients who underwent CCACCTGGAGGGCATGACTA, DNp73.RW:CGCTTTTCCC- radical surgery at the San Luigi Hospital, Division of Tho- ATCTCCCTTAG, DNЈp73.FW:CACGGCACCTCGCCAC, racic Surgery, between December 2003 and March 2004, DNЈp73.RW:ATCTGGTCCATGGTGCTGCT, ACTB.FW: were analyzed. Median age of patients (34 men and 12 GAGTCCGGCCCCTCCAT, and ACTB.RW: GCAACTA- women) was 69 years (range 41–82 years), and none of them AGTCATAGTCCGCCTAGA. Melting curve analysis was received either preoperative or postoperative chemotherapy performed for all the amplicons. Quantitative PCR was car- or radio-therapy according to the institutional treatment pol- ried out on an ABI PRISM 7900HT Sequence Detection icy for resectable rescue in those years. Histological exami- System (Applied Biosystems) in 384-wells plates assembled nation was performed on formalin-fixed tissue in all cases, by Biorobot 8000, and reactions were performed in a final and tumors were diagnosed according to World Health Or- ␮ ganization classification,16 including 26 adenocarcinomas, 17 volume of 20 l. All quantitative PCR mixtures contained 1 ␮ ϫ squamous cell carcinomas, and 3 large cell carcinomas. l of complementary DNA template, 1 SYBR Universal ϫ Differentiation grade (grade 1: 9, grade 2: 18, and grade 3: 19 PCR Master Mix (2 , Applied Biosystems). Cycle condi- cases), pT status (pT1: 10, pT2: 33, pT3: 2, and pT4: 1 cases), tions were as follows: after an initial 2-minute hold at 50°C and pN status (pN0: 32, pN1: 8, and pN2: 6 cases) were also to allow AmpErase: UNG (Applied Biosystems) activity, and recorded. According to the tumor, node, metastasis classifi- 10 minutes at 95°C, the samples were cycled 40 times at 95°C cation for solid tumors,17 29 cases resulted to be pathological for 15 seconds and 60°C for 1 minute. For ⌬2/3p73 primers, stage I, 10 stage II, and 7 stage III. Follow-up was available annealing time was reduced down to 30 seconds and temper- in all cases. Informed consent was obtained from each pa- ature was increased up to 65°C to obtain a specific amplicon. tient, and the study was approved by the institutional review Baseline and threshold for Ct calculation were set manually board of the San Luigi Hospital. All samples were deidenti- with the ABI Prism SDS version 2.1 software (Applied fied and cases anonymized by a staff member not involved in Biosystems). the study. Clinical data were compared and analyzed through coded data. Immunohistochemistry RNA Extraction, Complementary DNA Formalin-fixed, paraffin-embedded tissues were cut Synthesis, and Quantitative Polymerase Chain into 4-␮m thick sections and collected onto charged slides for Reaction immunohistochemical staining. After deparaffination and re- Total RNA (totRNA) was isolated from all tissue spec- hydration through graded alcohols and phosphate-buffered imens with the RNeasy 96 Kit and Biorobot 8000 (Qiagen, saline (pH 7.5), the endogenous peroxidase activity was Hilden, Germany) according to the manufacturer’s instruc- blocked by incubation with absolute methanol and 0.3% tions. RNA was extracted from 15 to 25 mg and 60 to 80 mg hydrogen peroxide for 15 minutes. Sections were incubated at of tumor and normal lung tissues specimens, respectively. the optimal conditions with the following primary antibodies: Genomic DNA contamination was removed by on-column- (1) mouse monoclonal antibody anti-ki67 (1:300; MIB-1, DNAseI treatment (Qiagen). totRNA was then quantified DakoCytomation, Glostrup, Denmark); (2) rabbit polyclonal with an Agilent 2100 Bioanalyzer (Agilent Technologies, p73 (1:500; AB14430, Abcam, Cambridge, UK) epitope Ϫ Palo Alto, CA) and stored at 80°C. Two micrograms of corresponding to the NH2-terminal region (this antibody totRNA were finally retrotranscribed with random hexamer recognizes the TAp73 isoforms but does not detect the primers and Multiscribe